Incidental Mutation 'R8231:Ptpra'
ID637133
Institutional Source Beutler Lab
Gene Symbol Ptpra
Ensembl Gene ENSMUSG00000027303
Gene Nameprotein tyrosine phosphatase, receptor type, A
SynonymsPTPalpha, RPTRalpha, Ptpa, PTP[a], RPTPalpha
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location130450278-130556124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 130537603 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 359 (N359S)
Ref Sequence ENSEMBL: ENSMUSP00000076533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028769] [ENSMUST00000077303]
PDB Structure
Crystal structure of the D2 domain of RPTPa [X-RAY DIFFRACTION]
RECEPTOR PROTEIN TYROSINE PHOSPHATASE ALPHA, DOMAIN 1 FROM MOUSE [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028769
AA Change: N323S

PolyPhen 2 Score 0.412 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000028769
Gene: ENSMUSG00000027303
AA Change: N323S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 494 6.01e-130 SMART
PTPc 523 784 3.56e-132 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000077303
AA Change: N359S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000076533
Gene: ENSMUSG00000027303
AA Change: N359S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 530 2.03e-118 SMART
PTPc 559 820 3.56e-132 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. This PTP has been shown to dephosphorylate and activate Src family tyrosine kinases, and is implicated in the regulation of integrin signaling, cell adhesion and proliferation. Three alternatively spliced variants of this gene, which encode two distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit deficits in Morris water maze learning, reduced locomotor activity, and decreased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in Ptpra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Ptpra APN 2 130544439 missense probably damaging 1.00
IGL01734:Ptpra APN 2 130544077 missense probably damaging 1.00
IGL02218:Ptpra APN 2 130552335 splice site probably benign
IGL02385:Ptpra APN 2 130540473 unclassified probably benign
IGL02480:Ptpra APN 2 130504261 missense probably benign 0.09
IGL03181:Ptpra APN 2 130517787 missense probably damaging 0.99
R0374:Ptpra UTSW 2 130537621 missense probably damaging 1.00
R0483:Ptpra UTSW 2 130539685 missense probably damaging 1.00
R0848:Ptpra UTSW 2 130518991 missense probably damaging 1.00
R1550:Ptpra UTSW 2 130541393 missense possibly damaging 0.86
R1596:Ptpra UTSW 2 130544952 missense probably damaging 1.00
R1689:Ptpra UTSW 2 130503492 missense probably benign 0.01
R1760:Ptpra UTSW 2 130549827 missense probably damaging 1.00
R1943:Ptpra UTSW 2 130544104 missense probably damaging 1.00
R2114:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2115:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2117:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2187:Ptpra UTSW 2 130504299 missense probably benign
R2848:Ptpra UTSW 2 130544999 missense probably benign 0.06
R2849:Ptpra UTSW 2 130544999 missense probably benign 0.06
R4644:Ptpra UTSW 2 130544158 missense probably damaging 1.00
R4779:Ptpra UTSW 2 130537617 missense probably damaging 1.00
R4849:Ptpra UTSW 2 130532161 missense probably damaging 1.00
R4899:Ptpra UTSW 2 130544436 missense probably damaging 1.00
R5657:Ptpra UTSW 2 130504284 missense probably benign 0.06
R6018:Ptpra UTSW 2 130503502 missense probably benign
R6234:Ptpra UTSW 2 130537588 missense probably damaging 1.00
R6350:Ptpra UTSW 2 130540592 missense probably damaging 1.00
R6856:Ptpra UTSW 2 130519381 missense probably damaging 1.00
R7072:Ptpra UTSW 2 130553430 missense probably damaging 1.00
R7146:Ptpra UTSW 2 130537651 critical splice donor site probably null
R7220:Ptpra UTSW 2 130544497 missense probably damaging 1.00
R7346:Ptpra UTSW 2 130553400 missense probably damaging 1.00
R7819:Ptpra UTSW 2 130504206 missense probably benign
R8044:Ptpra UTSW 2 130544961 missense possibly damaging 0.93
R8404:Ptpra UTSW 2 130549759 missense probably damaging 1.00
R8422:Ptpra UTSW 2 130532171 missense possibly damaging 0.86
R8502:Ptpra UTSW 2 130549759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCGATACATGGGAAACATTC -3'
(R):5'- TTAGCCTGCCTGGACAATCTAC -3'

Sequencing Primer
(F):5'- CATGGGAAACATTCACTTGTCAGGTG -3'
(R):5'- CTGCCTGGACAATCTACTAGTGGAG -3'
Posted On2020-07-13