Incidental Mutation 'R8231:Megf6'
ID637136
Institutional Source Beutler Lab
Gene Symbol Megf6
Ensembl Gene ENSMUSG00000057751
Gene Namemultiple EGF-like-domains 6
Synonyms2600001P17Rik, Egfl3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location154170730-154275713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 154252518 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tryptophan at position 359 (C359W)
Ref Sequence ENSEMBL: ENSMUSP00000030897 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030897] [ENSMUST00000152159]
Predicted Effect probably damaging
Transcript: ENSMUST00000030897
AA Change: C359W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030897
Gene: ENSMUSG00000057751
AA Change: C359W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
EGF_CA 122 162 1.54e-6 SMART
EGF_CA 163 203 2.08e-12 SMART
EGF 207 245 5.4e-2 SMART
EGF 249 286 2.39e-3 SMART
EGF_CA 287 327 4.96e-10 SMART
EGF 336 373 1.64e-1 SMART
EGF 377 413 1.99e1 SMART
EGF_CA 414 454 7.4e-9 SMART
EGF 521 554 4.26e0 SMART
EGF_Lam 570 609 1.19e-3 SMART
EGF_like 613 652 5.29e-1 SMART
EGF 642 685 2.2e1 SMART
EGF_Lam 656 697 1.04e-3 SMART
EGF 687 730 1.59e1 SMART
EGF_like 701 742 2.27e0 SMART
EGF_Lam 746 784 1.33e-1 SMART
EGF 783 816 2.85e-1 SMART
EGF_Lam 832 871 3.88e-3 SMART
EGF_Lam 875 915 3.25e-5 SMART
EGF 914 946 4.7e-2 SMART
EGF_like 962 1001 1.69e-1 SMART
EGF 1000 1032 7.02e-1 SMART
EGF_Lam 1048 1087 3.1e-2 SMART
EGF 1077 1118 7.53e-1 SMART
EGF_like 1091 1130 5.59e-1 SMART
EGF 1129 1161 5.04e-2 SMART
EGF_Lam 1177 1216 2.94e-3 SMART
EGF 1206 1248 1.87e1 SMART
EGF_Lam 1220 1260 3.1e-2 SMART
EGF 1259 1291 1.73e0 SMART
EGF 1302 1334 6.55e-1 SMART
EGF 1345 1377 4.39e-2 SMART
EGF_Lam 1393 1432 7.64e-2 SMART
EGF_Lam 1436 1475 2.64e-5 SMART
EGF_like 1465 1506 4.2e1 SMART
EGF_Lam 1479 1518 1.19e-3 SMART
EGF 1517 1549 1.84e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000152159
AA Change: C251W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121641
Gene: ENSMUSG00000057751
AA Change: C251W

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF_CA 55 95 2.08e-12 SMART
EGF 99 137 5.4e-2 SMART
EGF 141 178 2.39e-3 SMART
EGF_CA 179 219 4.96e-10 SMART
EGF 228 265 1.64e-1 SMART
EGF 269 305 1.99e1 SMART
EGF_CA 306 346 7.4e-9 SMART
EGF 413 446 4.26e0 SMART
EGF_Lam 462 501 1.19e-3 SMART
EGF_like 505 544 5.29e-1 SMART
EGF 534 577 2.2e1 SMART
EGF_Lam 548 589 1.04e-3 SMART
EGF 579 622 1.59e1 SMART
EGF_like 593 634 2.27e0 SMART
EGF_Lam 638 676 1.33e-1 SMART
EGF 675 708 2.85e-1 SMART
EGF_Lam 724 763 3.88e-3 SMART
EGF_Lam 767 807 3.25e-5 SMART
EGF 806 838 4.7e-2 SMART
EGF_Lam 854 893 2.56e-3 SMART
EGF 892 924 2.02e-1 SMART
EGF 935 967 7.13e-2 SMART
EGF 978 1010 1.73e0 SMART
EGF 1021 1053 6.55e-1 SMART
EGF 1064 1096 4.39e-2 SMART
EGF 1107 1139 4.97e-1 SMART
EGF 1159 1191 1.84e1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in Megf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01122:Megf6 APN 4 154253807 missense probably damaging 1.00
IGL01410:Megf6 APN 4 154252563 critical splice donor site probably null
IGL01512:Megf6 APN 4 154262583 missense possibly damaging 0.64
IGL01824:Megf6 APN 4 154252234 missense probably damaging 1.00
IGL02172:Megf6 APN 4 154270692 missense probably damaging 1.00
IGL02727:Megf6 APN 4 154253149 splice site probably null
IGL02966:Megf6 APN 4 154253777 missense probably damaging 1.00
Didactic UTSW 4 154254587 missense probably damaging 1.00
R0118:Megf6 UTSW 4 154254641 missense probably damaging 0.99
R0220:Megf6 UTSW 4 154258215 missense probably damaging 1.00
R0347:Megf6 UTSW 4 154254635 missense possibly damaging 0.90
R0383:Megf6 UTSW 4 154265326 missense probably benign 0.01
R0417:Megf6 UTSW 4 154267967 missense probably benign 0.06
R0526:Megf6 UTSW 4 154258941 missense probably benign
R0528:Megf6 UTSW 4 154259173 missense probably benign 0.04
R0928:Megf6 UTSW 4 154177047 missense probably damaging 1.00
R1311:Megf6 UTSW 4 154263782 splice site probably null
R1458:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1470:Megf6 UTSW 4 154252419 splice site probably benign
R1476:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1479:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1624:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1626:Megf6 UTSW 4 154177121 missense probably benign 0.39
R1638:Megf6 UTSW 4 154262510 splice site probably benign
R1777:Megf6 UTSW 4 154270690 nonsense probably null
R1831:Megf6 UTSW 4 154270677 missense probably benign 0.00
R1944:Megf6 UTSW 4 154256066 missense possibly damaging 0.75
R1984:Megf6 UTSW 4 154267667 missense probably damaging 1.00
R2109:Megf6 UTSW 4 154177121 missense probably benign 0.39
R2448:Megf6 UTSW 4 154266645 splice site probably null
R2880:Megf6 UTSW 4 154252549 missense probably damaging 1.00
R4032:Megf6 UTSW 4 154177093 nonsense probably null
R4058:Megf6 UTSW 4 154242532 splice site probably benign
R4672:Megf6 UTSW 4 154249452 missense probably damaging 0.99
R4688:Megf6 UTSW 4 154253814 missense probably damaging 0.99
R4752:Megf6 UTSW 4 154252438 missense probably damaging 1.00
R4863:Megf6 UTSW 4 154254281 critical splice donor site probably null
R4909:Megf6 UTSW 4 154265391 missense probably damaging 1.00
R4942:Megf6 UTSW 4 154253820 missense probably damaging 1.00
R4981:Megf6 UTSW 4 154267450 missense possibly damaging 0.95
R4990:Megf6 UTSW 4 154267226 missense possibly damaging 0.94
R5001:Megf6 UTSW 4 154268060 missense probably damaging 1.00
R5189:Megf6 UTSW 4 154252523 missense probably benign 0.31
R5210:Megf6 UTSW 4 154269816 intron probably benign
R5220:Megf6 UTSW 4 154253838 critical splice donor site probably null
R5250:Megf6 UTSW 4 154256010 missense possibly damaging 0.65
R5697:Megf6 UTSW 4 154258229 missense probably null 0.15
R5808:Megf6 UTSW 4 154267662 missense probably benign
R5916:Megf6 UTSW 4 154249425 critical splice acceptor site probably null
R6054:Megf6 UTSW 4 154263179 missense probably benign 0.06
R6075:Megf6 UTSW 4 154262599 nonsense probably null
R6515:Megf6 UTSW 4 154258919 missense possibly damaging 0.84
R6599:Megf6 UTSW 4 154258087 splice site probably null
R6811:Megf6 UTSW 4 154252161 missense probably damaging 1.00
R6925:Megf6 UTSW 4 154254587 missense probably damaging 1.00
R7023:Megf6 UTSW 4 154254145 missense possibly damaging 0.95
R7117:Megf6 UTSW 4 154258922 missense possibly damaging 0.78
R7163:Megf6 UTSW 4 154267441 missense probably damaging 0.98
R7345:Megf6 UTSW 4 154267315 missense probably benign
R7580:Megf6 UTSW 4 154270744 nonsense probably null
R7649:Megf6 UTSW 4 154265085 missense probably damaging 0.96
R7702:Megf6 UTSW 4 154270470 missense probably benign 0.00
R8010:Megf6 UTSW 4 154270507 missense probably benign 0.13
R8175:Megf6 UTSW 4 154268619 nonsense probably null
Z1177:Megf6 UTSW 4 154237826 missense probably benign 0.12
Z1177:Megf6 UTSW 4 154250849 missense probably damaging 1.00
Z1177:Megf6 UTSW 4 154267681 missense possibly damaging 0.48
Z1177:Megf6 UTSW 4 154267682 missense probably damaging 0.99
Z1177:Megf6 UTSW 4 154267747 nonsense probably null
Z1177:Megf6 UTSW 4 154269741 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGTCAGTTTCAGTTGGGCAGC -3'
(R):5'- TGCTGATGCTGACTCTTGTC -3'

Sequencing Primer
(F):5'- CAGTTGGGCAGCTCTGG -3'
(R):5'- GACTCTTGTCAACTCTCCTGCAG -3'
Posted On2020-07-13