Incidental Mutation 'R8231:4930548H24Rik'
ID637138
Institutional Source Beutler Lab
Gene Symbol 4930548H24Rik
Ensembl Gene ENSMUSG00000029138
Gene NameRIKEN cDNA 4930548H24 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location31485740-31488476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 31486207 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 94 (C94S)
Ref Sequence ENSEMBL: ENSMUSP00000031020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031020] [ENSMUST00000076264] [ENSMUST00000202244]
Predicted Effect probably benign
Transcript: ENSMUST00000031020
AA Change: C94S

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000031020
Gene: ENSMUSG00000029138
AA Change: C94S

DomainStartEndE-ValueType
coiled coil region 151 195 N/A INTRINSIC
Pfam:DUF4515 202 407 2e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076264
SMART Domains Protein: ENSMUSP00000075613
Gene: ENSMUSG00000062761

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
Blast:ZnF_C2H2 172 197 2e-8 BLAST
ZnF_C2H2 200 223 3.78e-1 SMART
ZnF_C2H2 254 276 2.63e2 SMART
ZnF_C2H2 290 313 3.39e-3 SMART
ZnF_C2H2 408 430 7.37e1 SMART
ZnF_C2H2 442 465 3.11e-2 SMART
low complexity region 485 511 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202244
SMART Domains Protein: ENSMUSP00000143860
Gene: ENSMUSG00000062761

DomainStartEndE-ValueType
low complexity region 51 65 N/A INTRINSIC
low complexity region 92 106 N/A INTRINSIC
Blast:ZnF_C2H2 172 197 1e-8 BLAST
ZnF_C2H2 200 223 1.6e-3 SMART
ZnF_C2H2 352 374 3.2e-1 SMART
ZnF_C2H2 386 409 1.4e-4 SMART
low complexity region 429 455 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in 4930548H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:4930548H24Rik APN 5 31487427 missense probably benign 0.00
IGL02009:4930548H24Rik APN 5 31487491 missense probably benign 0.00
FR4304:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4340:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4342:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4589:4930548H24Rik UTSW 5 31487373 small deletion probably benign
LCD18:4930548H24Rik UTSW 5 31487373 small deletion probably benign
PIT4486001:4930548H24Rik UTSW 5 31487743 missense probably damaging 0.99
R0650:4930548H24Rik UTSW 5 31485968 unclassified probably benign
R1366:4930548H24Rik UTSW 5 31487517 missense probably benign 0.07
R2050:4930548H24Rik UTSW 5 31486058 missense possibly damaging 0.68
R2070:4930548H24Rik UTSW 5 31487383 missense possibly damaging 0.91
R2862:4930548H24Rik UTSW 5 31485911 unclassified probably benign
R3965:4930548H24Rik UTSW 5 31487991 missense probably benign 0.02
R4299:4930548H24Rik UTSW 5 31487526 missense possibly damaging 0.82
R4634:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4635:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4637:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4887:4930548H24Rik UTSW 5 31486252 missense probably benign 0.19
R5587:4930548H24Rik UTSW 5 31486084 missense probably benign
R5897:4930548H24Rik UTSW 5 31485964 unclassified probably benign
R6181:4930548H24Rik UTSW 5 31488055 missense probably damaging 0.98
R6183:4930548H24Rik UTSW 5 31487976 missense probably damaging 0.99
R8028:4930548H24Rik UTSW 5 31487922 missense possibly damaging 0.92
RF006:4930548H24Rik UTSW 5 31487550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GACTCCCAAATGCAGTGTGAC -3'
(R):5'- CTGGTGATTTCAAGTCTTCATGC -3'

Sequencing Primer
(F):5'- GTGACTGCATTTCACAGGAC -3'
(R):5'- AAGTCTTCATGCCACGTGG -3'
Posted On2020-07-13