Incidental Mutation 'R8231:E330009J07Rik'
ID637140
Institutional Source Beutler Lab
Gene Symbol E330009J07Rik
Ensembl Gene ENSMUSG00000037172
Gene NameRIKEN cDNA E330009J07 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location40401375-40436135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40418612 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 187 (H187Q)
Ref Sequence ENSEMBL: ENSMUSP00000099031 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039008] [ENSMUST00000101492] [ENSMUST00000201712]
Predicted Effect probably benign
Transcript: ENSMUST00000039008
AA Change: H187Q

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045103
Gene: ENSMUSG00000037172
AA Change: H187Q

DomainStartEndE-ValueType
low complexity region 30 60 N/A INTRINSIC
Pfam:DUF2347 80 347 3.4e-79 PFAM
Pfam:SPA 234 345 5.2e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101492
AA Change: H187Q

PolyPhen 2 Score 0.352 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099031
Gene: ENSMUSG00000037172
AA Change: H187Q

DomainStartEndE-ValueType
low complexity region 30 60 N/A INTRINSIC
Pfam:DUF2347 80 347 3.2e-78 PFAM
Pfam:SPA 234 345 6.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201712
AA Change: H115Q

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000143916
Gene: ENSMUSG00000037172
AA Change: H115Q

DomainStartEndE-ValueType
Pfam:DUF2347 15 133 1.4e-29 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in E330009J07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02813:E330009J07Rik APN 6 40418539 missense probably benign 0.00
IGL03143:E330009J07Rik APN 6 40422894 splice site probably benign
R1812:E330009J07Rik UTSW 6 40409431 missense probably benign 0.02
R1928:E330009J07Rik UTSW 6 40411714 missense probably benign 0.14
R2443:E330009J07Rik UTSW 6 40406776 missense probably damaging 0.99
R3012:E330009J07Rik UTSW 6 40435992 missense probably benign
R6913:E330009J07Rik UTSW 6 40406917 missense possibly damaging 0.91
R7318:E330009J07Rik UTSW 6 40409164 missense possibly damaging 0.72
R7456:E330009J07Rik UTSW 6 40406840 missense probably benign 0.33
R8087:E330009J07Rik UTSW 6 40418592 missense possibly damaging 0.94
Y4340:E330009J07Rik UTSW 6 40436058 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCATGAGGCTGAAGCATAATTTC -3'
(R):5'- CCGTTGAATTTCAGACCTTGTG -3'

Sequencing Primer
(F):5'- TGAGGCTGAAGCATAATTTCTTTATC -3'
(R):5'- AATTTCAGACCTTGTGTTTGAGC -3'
Posted On2020-07-13