Incidental Mutation 'R8231:Pnmal2'
ID637142
Institutional Source Beutler Lab
Gene Symbol Pnmal2
Ensembl Gene ENSMUSG00000070802
Gene NamePNMA-like 2
SynonymsEG434128
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location16944682-16948828 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16946590 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 500 (C500R)
Ref Sequence ENSEMBL: ENSMUSP00000092401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094807]
Predicted Effect probably benign
Transcript: ENSMUST00000094807
AA Change: C500R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000092401
Gene: ENSMUSG00000070802
AA Change: C500R

DomainStartEndE-ValueType
Pfam:PNMA 1 152 4.1e-36 PFAM
low complexity region 172 196 N/A INTRINSIC
internal_repeat_1 239 296 1.86e-6 PROSPERO
SCOP:d1qbkb_ 309 331 2e-3 SMART
internal_repeat_1 343 402 1.86e-6 PROSPERO
low complexity region 445 454 N/A INTRINSIC
low complexity region 466 475 N/A INTRINSIC
low complexity region 483 498 N/A INTRINSIC
low complexity region 518 551 N/A INTRINSIC
low complexity region 571 596 N/A INTRINSIC
low complexity region 612 636 N/A INTRINSIC
low complexity region 646 659 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in Pnmal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Pnmal2 APN 7 16945163 missense unknown
IGL02023:Pnmal2 APN 7 16945691 missense probably damaging 0.97
FR4737:Pnmal2 UTSW 7 16946006 small deletion probably benign
R0085:Pnmal2 UTSW 7 16945549 missense unknown
R2069:Pnmal2 UTSW 7 16945789 missense probably damaging 0.99
R2151:Pnmal2 UTSW 7 16945912 missense probably benign 0.00
R2321:Pnmal2 UTSW 7 16945565 missense unknown
R2929:Pnmal2 UTSW 7 16946692 missense possibly damaging 0.93
R3738:Pnmal2 UTSW 7 16946596 missense probably benign 0.00
R3739:Pnmal2 UTSW 7 16946596 missense probably benign 0.00
R5185:Pnmal2 UTSW 7 16945976 missense probably damaging 1.00
R5259:Pnmal2 UTSW 7 16945274 missense unknown
R5908:Pnmal2 UTSW 7 16947043 missense unknown
R5943:Pnmal2 UTSW 7 16946437 missense probably benign 0.25
R6101:Pnmal2 UTSW 7 16946568 missense probably benign 0.20
R6260:Pnmal2 UTSW 7 16946233 missense probably benign 0.03
R6583:Pnmal2 UTSW 7 16945919 missense probably damaging 0.97
R7007:Pnmal2 UTSW 7 16946256 missense possibly damaging 0.68
R7497:Pnmal2 UTSW 7 16944949 start gained probably benign
R8278:Pnmal2 UTSW 7 16946338 missense probably damaging 0.99
RF003:Pnmal2 UTSW 7 16946016 small insertion probably benign
Z1176:Pnmal2 UTSW 7 16946810 missense possibly damaging 0.93
Z1177:Pnmal2 UTSW 7 16946968 missense unknown
Predicted Primers PCR Primer
(F):5'- ATTTCTACCTTGGCTGAGGCAG -3'
(R):5'- TTCTTCTCTGGGGTGACAGC -3'

Sequencing Primer
(F):5'- CTACCTTGGCTGAGGCAGAGAAC -3'
(R):5'- AGGCCTTTGGAGCCTGTGC -3'
Posted On2020-07-13