Incidental Mutation 'R8231:Tmem255b'
ID637144
Institutional Source Beutler Lab
Gene Symbol Tmem255b
Ensembl Gene ENSMUSG00000038457
Gene Nametransmembrane protein 255B
SynonymsFam70b, LOC272465
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location13435189-13468473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13454225 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 139 (D139G)
Ref Sequence ENSEMBL: ENSMUSP00000130504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167071] [ENSMUST00000167505] [ENSMUST00000210804]
Predicted Effect possibly damaging
Transcript: ENSMUST00000167071
AA Change: D118G

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127421
Gene: ENSMUSG00000038457
AA Change: D118G

DomainStartEndE-ValueType
Pfam:FAM70 1 68 8.2e-28 PFAM
Pfam:FAM70 66 307 1.8e-119 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167505
AA Change: D139G

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000130504
Gene: ENSMUSG00000038457
AA Change: D139G

DomainStartEndE-ValueType
Pfam:FAM70 6 328 6e-166 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210804
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in Tmem255b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Tmem255b APN 8 13457054 missense probably benign
IGL02635:Tmem255b APN 8 13455195 missense probably damaging 1.00
IGL02679:Tmem255b APN 8 13457055 missense probably benign 0.04
IGL02945:Tmem255b APN 8 13455141 missense probably damaging 0.98
IGL03007:Tmem255b APN 8 13457066 missense possibly damaging 0.94
IGL03146:Tmem255b APN 8 13454174 missense probably damaging 1.00
R2278:Tmem255b UTSW 8 13451081 missense probably damaging 1.00
R2410:Tmem255b UTSW 8 13441278 missense probably benign 0.22
R3081:Tmem255b UTSW 8 13451048 missense probably damaging 0.99
R4498:Tmem255b UTSW 8 13455998 missense probably damaging 1.00
R4612:Tmem255b UTSW 8 13454228 missense probably benign 0.00
R6018:Tmem255b UTSW 8 13455138 missense probably benign 0.00
R6073:Tmem255b UTSW 8 13456958 missense probably damaging 0.98
R6240:Tmem255b UTSW 8 13454216 missense probably damaging 1.00
R6737:Tmem255b UTSW 8 13457096 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAGGGTGTCTGTAATCCTTTCCC -3'
(R):5'- ATGCAGCTGTGATCCCAGAG -3'

Sequencing Primer
(F):5'- CTATGGCAAGCAGTAACTCGTGTG -3'
(R):5'- GCTGTGATCCCAGAGAGAACC -3'
Posted On2020-07-13