Incidental Mutation 'R8231:Dock4'
ID 637153
Institutional Source Beutler Lab
Gene Symbol Dock4
Ensembl Gene ENSMUSG00000035954
Gene Name dedicator of cytokinesis 4
Synonyms 6330411N01Rik, EST N28122
MMRRC Submission 067663-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.161) question?
Stock # R8231 (G1)
Quality Score 225.009
Status Not validated
Chromosome 12
Chromosomal Location 40495956-40896873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 40752950 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 428 (M428K)
Ref Sequence ENSEMBL: ENSMUSP00000047387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037488]
AlphaFold P59764
Predicted Effect possibly damaging
Transcript: ENSMUST00000037488
AA Change: M428K

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047387
Gene: ENSMUSG00000035954
AA Change: M428K

DomainStartEndE-ValueType
SH3 9 66 7.29e-10 SMART
Pfam:DOCK_N 69 392 8.2e-110 PFAM
Pfam:DOCK-C2 397 583 1.9e-55 PFAM
low complexity region 829 842 N/A INTRINSIC
Pfam:DHR-2 1092 1596 5e-108 PFAM
low complexity region 1651 1664 N/A INTRINSIC
low complexity region 1681 1696 N/A INTRINSIC
low complexity region 1700 1713 N/A INTRINSIC
low complexity region 1842 1872 N/A INTRINSIC
low complexity region 1883 1896 N/A INTRINSIC
low complexity region 1940 1950 N/A INTRINSIC
low complexity region 1958 1973 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the dedicator of cytokinesis (DOCK) family and encodes a protein with a DHR-1 (CZH-1) domain, a DHR-2 (CZH-2) domain and an SH3 domain. This membrane-associated, cytoplasmic protein functions as a guanine nucleotide exchange factor and is involved in regulation of adherens junctions between cells. Mutations in this gene have been associated with ovarian, prostate, glioma, and colorectal cancers. Alternatively spliced variants which encode different protein isoforms have been described, but only one has been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. Heterozygotes display altered blood vessel lumen formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 C T 17: 85,000,213 (GRCm39) R258C probably damaging Het
Acsf2 C G 11: 94,452,188 (GRCm39) E451D probably benign Het
Adam34 A T 8: 44,104,659 (GRCm39) S329T probably benign Het
Adamts16 A G 13: 70,925,599 (GRCm39) I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 (GRCm39) F214S probably damaging Het
Btg4 A G 9: 51,027,868 (GRCm39) T13A possibly damaging Het
Ccdc121 T A 5: 31,643,551 (GRCm39) C94S probably benign Het
Cplane1 T C 15: 8,248,511 (GRCm39) Y1687H probably benign Het
Csmd1 A T 8: 16,747,939 (GRCm39) S271T possibly damaging Het
Cul9 T C 17: 46,831,427 (GRCm39) T1596A probably damaging Het
Cyp2a4 G A 7: 26,012,362 (GRCm39) D382N probably benign Het
Dbh C T 2: 27,060,555 (GRCm39) R244C probably benign Het
Dennd11 A T 6: 40,395,546 (GRCm39) H187Q probably benign Het
Dnajc2 T C 5: 21,966,689 (GRCm39) K426R probably benign Het
Duox2 A T 2: 122,120,044 (GRCm39) M822K possibly damaging Het
Golga5 T C 12: 102,438,558 (GRCm39) V91A probably benign Het
Gpatch2l T C 12: 86,290,963 (GRCm39) S49P probably damaging Het
Ints7 T A 1: 191,328,465 (GRCm39) L246* probably null Het
Kntc1 A G 5: 123,920,959 (GRCm39) T926A possibly damaging Het
Kyat1 T C 2: 30,081,978 (GRCm39) T54A probably benign Het
Megf6 C G 4: 154,336,975 (GRCm39) C359W probably damaging Het
Mlh3 A G 12: 85,307,572 (GRCm39) probably null Het
Neb C A 2: 52,125,491 (GRCm39) probably null Het
Nyap2 A T 1: 81,169,846 (GRCm39) Q201L probably benign Het
Pibf1 T G 14: 99,423,997 (GRCm39) H523Q probably benign Het
Piezo1 A G 8: 123,232,836 (GRCm39) S133P Het
Pnma8b T C 7: 16,680,515 (GRCm39) C500R probably benign Het
Ptpra A G 2: 130,379,523 (GRCm39) N359S probably damaging Het
Rce1 A T 19: 4,675,078 (GRCm39) I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 (GRCm39) Y104H probably benign Het
Snx22 A T 9: 65,975,480 (GRCm39) D96E probably benign Het
Sox5 G T 6: 143,974,014 (GRCm39) Q245K probably damaging Het
Stat6 A G 10: 127,482,842 (GRCm39) D21G possibly damaging Het
Tbc1d15 T C 10: 115,065,045 (GRCm39) Y180C probably damaging Het
Tdrd6 T C 17: 43,933,026 (GRCm39) T2058A probably damaging Het
Thbs4 A T 13: 92,911,352 (GRCm39) V277E probably benign Het
Tmem255b A G 8: 13,504,225 (GRCm39) D139G probably damaging Het
Ttc27 C A 17: 75,024,959 (GRCm39) T18K probably benign Het
Zfp131 A G 13: 120,237,348 (GRCm39) F337L probably damaging Het
Other mutations in Dock4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Dock4 APN 12 40,882,305 (GRCm39) missense possibly damaging 0.48
IGL00726:Dock4 APN 12 40,840,067 (GRCm39) splice site probably benign
IGL00790:Dock4 APN 12 40,884,390 (GRCm39) missense probably damaging 1.00
IGL01061:Dock4 APN 12 40,752,968 (GRCm39) missense probably benign 0.01
IGL01083:Dock4 APN 12 40,838,380 (GRCm39) splice site probably benign
IGL01412:Dock4 APN 12 40,780,040 (GRCm39) splice site probably benign
IGL01583:Dock4 APN 12 40,860,466 (GRCm39) nonsense probably null
IGL01603:Dock4 APN 12 40,743,030 (GRCm39) missense probably damaging 1.00
IGL01766:Dock4 APN 12 40,496,378 (GRCm39) nonsense probably null
IGL02067:Dock4 APN 12 40,884,384 (GRCm39) missense probably damaging 1.00
IGL02302:Dock4 APN 12 40,775,776 (GRCm39) missense probably damaging 1.00
IGL02406:Dock4 APN 12 40,827,206 (GRCm39) missense probably benign 0.01
IGL02547:Dock4 APN 12 40,787,478 (GRCm39) missense probably benign
IGL02613:Dock4 APN 12 40,860,465 (GRCm39) missense probably damaging 1.00
IGL02643:Dock4 APN 12 40,718,429 (GRCm39) missense probably damaging 1.00
IGL02952:Dock4 APN 12 40,760,902 (GRCm39) critical splice donor site probably null
IGL02994:Dock4 APN 12 40,829,159 (GRCm39) missense probably damaging 0.99
IGL03096:Dock4 APN 12 40,798,000 (GRCm39) missense probably benign 0.00
IGL03144:Dock4 APN 12 40,742,906 (GRCm39) splice site probably benign
IGL03223:Dock4 APN 12 40,867,593 (GRCm39) missense probably damaging 1.00
IGL03296:Dock4 APN 12 40,783,256 (GRCm39) missense possibly damaging 0.84
IGL03349:Dock4 APN 12 40,783,309 (GRCm39) missense probably benign 0.42
IGL03353:Dock4 APN 12 40,867,757 (GRCm39) splice site probably null
BB005:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
BB015:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0046:Dock4 UTSW 12 40,787,359 (GRCm39) splice site probably benign
R0110:Dock4 UTSW 12 40,671,311 (GRCm39) splice site probably benign
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0238:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0239:Dock4 UTSW 12 40,787,539 (GRCm39) missense probably damaging 0.98
R0472:Dock4 UTSW 12 40,888,437 (GRCm39) intron probably benign
R0616:Dock4 UTSW 12 40,754,414 (GRCm39) missense probably benign 0.31
R0647:Dock4 UTSW 12 40,760,883 (GRCm39) missense probably damaging 1.00
R0706:Dock4 UTSW 12 40,752,922 (GRCm39) missense probably damaging 0.98
R0791:Dock4 UTSW 12 40,754,480 (GRCm39) missense probably damaging 1.00
R0940:Dock4 UTSW 12 40,681,626 (GRCm39) splice site probably benign
R1087:Dock4 UTSW 12 40,779,937 (GRCm39) missense probably benign 0.40
R1180:Dock4 UTSW 12 40,690,413 (GRCm39) missense possibly damaging 0.52
R1194:Dock4 UTSW 12 40,879,615 (GRCm39) missense probably damaging 1.00
R1463:Dock4 UTSW 12 40,866,324 (GRCm39) frame shift probably null
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1468:Dock4 UTSW 12 40,805,809 (GRCm39) missense probably benign 0.00
R1523:Dock4 UTSW 12 40,743,024 (GRCm39) missense possibly damaging 0.88
R1616:Dock4 UTSW 12 40,719,044 (GRCm39) missense probably damaging 0.99
R1682:Dock4 UTSW 12 40,775,779 (GRCm39) missense probably damaging 1.00
R1691:Dock4 UTSW 12 40,775,754 (GRCm39) missense probably benign 0.26
R1693:Dock4 UTSW 12 40,884,721 (GRCm39) missense probably benign 0.07
R1737:Dock4 UTSW 12 40,857,000 (GRCm39) splice site probably null
R1802:Dock4 UTSW 12 40,844,597 (GRCm39) missense possibly damaging 0.90
R1813:Dock4 UTSW 12 40,686,227 (GRCm39) missense probably damaging 1.00
R1846:Dock4 UTSW 12 40,783,267 (GRCm39) missense probably benign 0.00
R1959:Dock4 UTSW 12 40,760,797 (GRCm39) missense probably damaging 1.00
R1975:Dock4 UTSW 12 40,829,641 (GRCm39) splice site probably benign
R1986:Dock4 UTSW 12 40,780,062 (GRCm39) missense probably damaging 1.00
R2105:Dock4 UTSW 12 40,742,988 (GRCm39) missense probably benign 0.00
R2134:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2135:Dock4 UTSW 12 40,795,667 (GRCm39) missense probably benign
R2154:Dock4 UTSW 12 40,894,547 (GRCm39) small insertion probably benign
R2154:Dock4 UTSW 12 40,870,661 (GRCm39) missense probably damaging 1.00
R2864:Dock4 UTSW 12 40,780,072 (GRCm39) missense probably damaging 1.00
R2890:Dock4 UTSW 12 40,673,800 (GRCm39) critical splice acceptor site probably null
R3086:Dock4 UTSW 12 40,781,862 (GRCm39) missense probably benign 0.02
R3808:Dock4 UTSW 12 40,722,809 (GRCm39) missense probably damaging 0.99
R3811:Dock4 UTSW 12 40,829,123 (GRCm39) missense possibly damaging 0.87
R3836:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R3838:Dock4 UTSW 12 40,844,623 (GRCm39) critical splice donor site probably null
R4091:Dock4 UTSW 12 40,894,266 (GRCm39) missense probably damaging 0.99
R4735:Dock4 UTSW 12 40,681,525 (GRCm39) missense probably benign 0.31
R4752:Dock4 UTSW 12 40,496,364 (GRCm39) missense probably benign 0.04
R4828:Dock4 UTSW 12 40,718,436 (GRCm39) missense probably damaging 1.00
R5039:Dock4 UTSW 12 40,867,745 (GRCm39) missense probably damaging 1.00
R5092:Dock4 UTSW 12 40,894,440 (GRCm39) missense probably benign
R5146:Dock4 UTSW 12 40,699,491 (GRCm39) splice site probably null
R5213:Dock4 UTSW 12 40,726,741 (GRCm39) missense probably damaging 1.00
R5214:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.00
R5270:Dock4 UTSW 12 40,783,270 (GRCm39) missense probably benign 0.02
R5426:Dock4 UTSW 12 40,795,744 (GRCm39) missense probably damaging 1.00
R5474:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R5544:Dock4 UTSW 12 40,884,701 (GRCm39) missense possibly damaging 0.87
R5615:Dock4 UTSW 12 40,699,479 (GRCm39) missense probably benign 0.22
R5649:Dock4 UTSW 12 40,894,539 (GRCm39) missense probably benign 0.03
R5702:Dock4 UTSW 12 40,787,490 (GRCm39) missense probably benign 0.02
R5846:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R5847:Dock4 UTSW 12 40,671,250 (GRCm39) missense probably damaging 0.97
R5895:Dock4 UTSW 12 40,805,812 (GRCm39) missense probably damaging 1.00
R5997:Dock4 UTSW 12 40,805,833 (GRCm39) missense probably damaging 0.99
R6011:Dock4 UTSW 12 40,867,756 (GRCm39) critical splice donor site probably null
R6022:Dock4 UTSW 12 40,798,109 (GRCm39) missense probably benign 0.04
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6038:Dock4 UTSW 12 40,783,350 (GRCm39) splice site probably null
R6179:Dock4 UTSW 12 40,781,868 (GRCm39) missense probably benign 0.00
R6479:Dock4 UTSW 12 40,878,954 (GRCm39) missense probably damaging 1.00
R6516:Dock4 UTSW 12 40,781,898 (GRCm39) missense possibly damaging 0.94
R6748:Dock4 UTSW 12 40,754,465 (GRCm39) missense probably benign 0.44
R6752:Dock4 UTSW 12 40,870,616 (GRCm39) missense probably damaging 1.00
R6814:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6864:Dock4 UTSW 12 40,795,745 (GRCm39) missense probably damaging 1.00
R6872:Dock4 UTSW 12 40,862,325 (GRCm39) critical splice donor site probably null
R6891:Dock4 UTSW 12 40,829,135 (GRCm39) missense probably damaging 1.00
R6937:Dock4 UTSW 12 40,884,634 (GRCm39) missense probably benign 0.01
R6950:Dock4 UTSW 12 40,783,313 (GRCm39) missense possibly damaging 0.80
R7081:Dock4 UTSW 12 40,671,285 (GRCm39) missense probably damaging 1.00
R7129:Dock4 UTSW 12 40,878,878 (GRCm39) missense probably damaging 1.00
R7140:Dock4 UTSW 12 40,686,158 (GRCm39) missense probably benign 0.06
R7241:Dock4 UTSW 12 40,844,859 (GRCm39) missense probably damaging 1.00
R7378:Dock4 UTSW 12 40,838,243 (GRCm39) missense possibly damaging 0.94
R7714:Dock4 UTSW 12 40,775,648 (GRCm39) nonsense probably null
R7720:Dock4 UTSW 12 40,856,974 (GRCm39) missense probably damaging 0.99
R7756:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7758:Dock4 UTSW 12 40,760,878 (GRCm39) missense probably benign 0.02
R7759:Dock4 UTSW 12 40,867,735 (GRCm39) missense probably damaging 1.00
R7787:Dock4 UTSW 12 40,775,676 (GRCm39) missense probably benign
R7879:Dock4 UTSW 12 40,780,083 (GRCm39) missense possibly damaging 0.76
R7928:Dock4 UTSW 12 40,838,302 (GRCm39) missense probably damaging 0.98
R8000:Dock4 UTSW 12 40,883,118 (GRCm39) missense probably benign 0.05
R8042:Dock4 UTSW 12 40,795,759 (GRCm39) missense probably benign 0.01
R8234:Dock4 UTSW 12 40,884,837 (GRCm39) splice site probably null
R8758:Dock4 UTSW 12 40,838,231 (GRCm39) missense probably benign 0.12
R8871:Dock4 UTSW 12 40,795,730 (GRCm39) missense probably benign
R8873:Dock4 UTSW 12 40,726,767 (GRCm39) nonsense probably null
R8884:Dock4 UTSW 12 40,856,884 (GRCm39) missense probably damaging 1.00
R9164:Dock4 UTSW 12 40,754,337 (GRCm39) missense probably damaging 1.00
R9225:Dock4 UTSW 12 40,879,669 (GRCm39) missense probably benign 0.02
R9276:Dock4 UTSW 12 40,699,404 (GRCm39) missense possibly damaging 0.48
R9307:Dock4 UTSW 12 40,686,155 (GRCm39) missense probably damaging 1.00
R9675:Dock4 UTSW 12 40,894,393 (GRCm39) small insertion probably benign
R9675:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,397 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9676:Dock4 UTSW 12 40,894,401 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,396 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,387 (GRCm39) small insertion probably benign
R9678:Dock4 UTSW 12 40,894,379 (GRCm39) small insertion probably benign
R9691:Dock4 UTSW 12 40,686,097 (GRCm39) missense probably damaging 1.00
RF018:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
RF025:Dock4 UTSW 12 40,894,392 (GRCm39) frame shift probably null
RF063:Dock4 UTSW 12 40,894,398 (GRCm39) frame shift probably null
X0028:Dock4 UTSW 12 40,719,046 (GRCm39) missense probably benign 0.25
Z1176:Dock4 UTSW 12 40,681,615 (GRCm39) missense probably benign 0.16
Z1176:Dock4 UTSW 12 40,681,613 (GRCm39) missense probably benign 0.01
Z1177:Dock4 UTSW 12 40,867,640 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCCAGTGTTGATAAGCAGCG -3'
(R):5'- GGAAAGTGAAAACACCGTTTCC -3'

Sequencing Primer
(F):5'- AACCACGTGTTTTTACAAACTAACG -3'
(R):5'- CTGGGAATTGAACTCAGGACCTCTG -3'
Posted On 2020-07-13