Incidental Mutation 'R8231:Adamts16'
ID 637157
Institutional Source Beutler Lab
Gene Symbol Adamts16
Ensembl Gene ENSMUSG00000049538
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 16
Synonyms
MMRRC Submission 067663-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8231 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 70875921-70989930 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 70925599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 535 (I535T)
Ref Sequence ENSEMBL: ENSMUSP00000079041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000109694] [ENSMUST00000123552]
AlphaFold Q69Z28
Predicted Effect probably damaging
Transcript: ENSMUST00000080145
AA Change: I535T

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: I535T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 57 203 7.8e-34 PFAM
Pfam:Reprolysin_5 287 470 2.9e-13 PFAM
Pfam:Reprolysin_4 289 489 1.2e-8 PFAM
Pfam:Reprolysin 289 493 5.4e-32 PFAM
Pfam:Reprolysin_2 306 483 3.7e-10 PFAM
Pfam:Reprolysin_3 310 442 6.4e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
TSP1 872 926 3.48e0 SMART
TSP1 928 985 4.84e-3 SMART
TSP1 987 1046 1.49e-3 SMART
TSP1 1052 1113 3.19e-2 SMART
TSP1 1127 1179 7.68e-6 SMART
Pfam:PLAC 1188 1218 2.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109694
AA Change: I535T

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105316
Gene: ENSMUSG00000049538
AA Change: I535T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 2.2e-32 PFAM
Pfam:Reprolysin_5 287 470 1.8e-13 PFAM
Pfam:Reprolysin_4 289 489 7.3e-9 PFAM
Pfam:Reprolysin 289 493 4.6e-33 PFAM
Pfam:Reprolysin_2 306 483 4.1e-10 PFAM
Pfam:Reprolysin_3 310 442 3.3e-10 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123552
AA Change: I535T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538
AA Change: I535T

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 5.9e-33 PFAM
Pfam:Reprolysin_5 287 470 5.1e-14 PFAM
Pfam:Reprolysin_4 289 489 2.2e-9 PFAM
Pfam:Reprolysin 289 493 1.2e-33 PFAM
Pfam:Reprolysin_2 306 483 1.2e-10 PFAM
Pfam:Reprolysin_3 310 442 9.7e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 C T 17: 85,000,213 (GRCm39) R258C probably damaging Het
Acsf2 C G 11: 94,452,188 (GRCm39) E451D probably benign Het
Adam34 A T 8: 44,104,659 (GRCm39) S329T probably benign Het
Atp6v0d2 A G 4: 19,881,451 (GRCm39) F214S probably damaging Het
Btg4 A G 9: 51,027,868 (GRCm39) T13A possibly damaging Het
Ccdc121 T A 5: 31,643,551 (GRCm39) C94S probably benign Het
Cplane1 T C 15: 8,248,511 (GRCm39) Y1687H probably benign Het
Csmd1 A T 8: 16,747,939 (GRCm39) S271T possibly damaging Het
Cul9 T C 17: 46,831,427 (GRCm39) T1596A probably damaging Het
Cyp2a4 G A 7: 26,012,362 (GRCm39) D382N probably benign Het
Dbh C T 2: 27,060,555 (GRCm39) R244C probably benign Het
Dennd11 A T 6: 40,395,546 (GRCm39) H187Q probably benign Het
Dnajc2 T C 5: 21,966,689 (GRCm39) K426R probably benign Het
Dock4 T A 12: 40,752,950 (GRCm39) M428K possibly damaging Het
Duox2 A T 2: 122,120,044 (GRCm39) M822K possibly damaging Het
Golga5 T C 12: 102,438,558 (GRCm39) V91A probably benign Het
Gpatch2l T C 12: 86,290,963 (GRCm39) S49P probably damaging Het
Ints7 T A 1: 191,328,465 (GRCm39) L246* probably null Het
Kntc1 A G 5: 123,920,959 (GRCm39) T926A possibly damaging Het
Kyat1 T C 2: 30,081,978 (GRCm39) T54A probably benign Het
Megf6 C G 4: 154,336,975 (GRCm39) C359W probably damaging Het
Mlh3 A G 12: 85,307,572 (GRCm39) probably null Het
Neb C A 2: 52,125,491 (GRCm39) probably null Het
Nyap2 A T 1: 81,169,846 (GRCm39) Q201L probably benign Het
Pibf1 T G 14: 99,423,997 (GRCm39) H523Q probably benign Het
Piezo1 A G 8: 123,232,836 (GRCm39) S133P Het
Pnma8b T C 7: 16,680,515 (GRCm39) C500R probably benign Het
Ptpra A G 2: 130,379,523 (GRCm39) N359S probably damaging Het
Rce1 A T 19: 4,675,078 (GRCm39) I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 (GRCm39) Y104H probably benign Het
Snx22 A T 9: 65,975,480 (GRCm39) D96E probably benign Het
Sox5 G T 6: 143,974,014 (GRCm39) Q245K probably damaging Het
Stat6 A G 10: 127,482,842 (GRCm39) D21G possibly damaging Het
Tbc1d15 T C 10: 115,065,045 (GRCm39) Y180C probably damaging Het
Tdrd6 T C 17: 43,933,026 (GRCm39) T2058A probably damaging Het
Thbs4 A T 13: 92,911,352 (GRCm39) V277E probably benign Het
Tmem255b A G 8: 13,504,225 (GRCm39) D139G probably damaging Het
Ttc27 C A 17: 75,024,959 (GRCm39) T18K probably benign Het
Zfp131 A G 13: 120,237,348 (GRCm39) F337L probably damaging Het
Other mutations in Adamts16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Adamts16 APN 13 70,943,603 (GRCm39) missense probably benign 0.01
IGL01338:Adamts16 APN 13 70,984,234 (GRCm39) missense probably damaging 1.00
IGL01663:Adamts16 APN 13 70,941,260 (GRCm39) missense probably benign 0.01
IGL01804:Adamts16 APN 13 70,949,080 (GRCm39) nonsense probably null
IGL01874:Adamts16 APN 13 70,916,823 (GRCm39) missense possibly damaging 0.79
IGL01984:Adamts16 APN 13 70,935,266 (GRCm39) missense probably damaging 1.00
IGL02305:Adamts16 APN 13 70,921,048 (GRCm39) missense probably damaging 1.00
IGL02350:Adamts16 APN 13 70,886,704 (GRCm39) missense probably benign 0.00
IGL02357:Adamts16 APN 13 70,886,704 (GRCm39) missense probably benign 0.00
IGL02429:Adamts16 APN 13 70,935,289 (GRCm39) splice site probably benign
IGL02450:Adamts16 APN 13 70,984,419 (GRCm39) missense probably damaging 0.97
IGL02807:Adamts16 APN 13 70,886,897 (GRCm39) critical splice donor site probably null
IGL03356:Adamts16 APN 13 70,901,410 (GRCm39) missense probably benign 0.00
swap UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
switcheroo UTSW 13 70,949,073 (GRCm39) missense probably benign
R0046:Adamts16 UTSW 13 70,911,579 (GRCm39) missense probably benign 0.00
R0046:Adamts16 UTSW 13 70,911,579 (GRCm39) missense probably benign 0.00
R0201:Adamts16 UTSW 13 70,927,763 (GRCm39) missense possibly damaging 0.69
R0326:Adamts16 UTSW 13 70,927,730 (GRCm39) missense possibly damaging 0.89
R0336:Adamts16 UTSW 13 70,939,913 (GRCm39) critical splice donor site probably benign
R0369:Adamts16 UTSW 13 70,927,671 (GRCm39) missense possibly damaging 0.94
R0422:Adamts16 UTSW 13 70,887,074 (GRCm39) missense probably damaging 1.00
R0507:Adamts16 UTSW 13 70,916,766 (GRCm39) missense probably benign
R0524:Adamts16 UTSW 13 70,949,013 (GRCm39) missense probably benign 0.00
R0590:Adamts16 UTSW 13 70,949,073 (GRCm39) missense probably benign
R0734:Adamts16 UTSW 13 70,886,600 (GRCm39) splice site probably benign
R0787:Adamts16 UTSW 13 70,886,948 (GRCm39) missense probably damaging 1.00
R0826:Adamts16 UTSW 13 70,916,811 (GRCm39) missense possibly damaging 0.64
R0920:Adamts16 UTSW 13 70,911,680 (GRCm39) splice site probably benign
R1027:Adamts16 UTSW 13 70,915,921 (GRCm39) missense probably damaging 1.00
R1462:Adamts16 UTSW 13 70,984,253 (GRCm39) missense probably benign 0.00
R1462:Adamts16 UTSW 13 70,984,253 (GRCm39) missense probably benign 0.00
R1535:Adamts16 UTSW 13 70,939,913 (GRCm39) critical splice donor site probably null
R1617:Adamts16 UTSW 13 70,946,154 (GRCm39) missense probably benign 0.09
R1700:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1734:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1736:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1737:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1738:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1746:Adamts16 UTSW 13 70,927,717 (GRCm39) splice site probably null
R1869:Adamts16 UTSW 13 70,883,866 (GRCm39) missense probably damaging 1.00
R1944:Adamts16 UTSW 13 70,940,005 (GRCm39) missense possibly damaging 0.93
R1997:Adamts16 UTSW 13 70,901,386 (GRCm39) missense probably benign 0.39
R2018:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R2135:Adamts16 UTSW 13 70,949,126 (GRCm39) missense probably damaging 1.00
R2219:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R2228:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R3410:Adamts16 UTSW 13 70,901,345 (GRCm39) missense probably benign 0.00
R3411:Adamts16 UTSW 13 70,901,345 (GRCm39) missense probably benign 0.00
R3842:Adamts16 UTSW 13 70,887,010 (GRCm39) missense possibly damaging 0.92
R4117:Adamts16 UTSW 13 70,916,111 (GRCm39) missense probably benign 0.01
R4435:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4436:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4526:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4552:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4555:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4556:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4557:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4579:Adamts16 UTSW 13 70,927,743 (GRCm39) missense probably damaging 1.00
R4639:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4640:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4641:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4642:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4672:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R5350:Adamts16 UTSW 13 70,901,315 (GRCm39) nonsense probably null
R5464:Adamts16 UTSW 13 70,909,868 (GRCm39) missense probably benign 0.01
R5613:Adamts16 UTSW 13 70,878,253 (GRCm39) missense probably benign 0.01
R5667:Adamts16 UTSW 13 70,984,494 (GRCm39) nonsense probably null
R5735:Adamts16 UTSW 13 70,984,337 (GRCm39) missense possibly damaging 0.94
R5762:Adamts16 UTSW 13 70,886,617 (GRCm39) missense probably damaging 1.00
R5907:Adamts16 UTSW 13 70,877,029 (GRCm39) missense probably damaging 1.00
R6169:Adamts16 UTSW 13 70,918,393 (GRCm39) nonsense probably null
R6351:Adamts16 UTSW 13 70,984,322 (GRCm39) missense probably damaging 1.00
R6665:Adamts16 UTSW 13 70,927,689 (GRCm39) missense probably damaging 1.00
R6913:Adamts16 UTSW 13 70,877,017 (GRCm39) missense possibly damaging 0.94
R6982:Adamts16 UTSW 13 70,916,639 (GRCm39) splice site probably null
R6996:Adamts16 UTSW 13 70,946,157 (GRCm39) critical splice acceptor site probably null
R7313:Adamts16 UTSW 13 70,921,074 (GRCm39) nonsense probably null
R7356:Adamts16 UTSW 13 70,984,399 (GRCm39) missense probably benign 0.03
R7509:Adamts16 UTSW 13 70,935,283 (GRCm39) missense probably damaging 1.00
R7595:Adamts16 UTSW 13 70,878,234 (GRCm39) missense probably damaging 1.00
R7782:Adamts16 UTSW 13 70,984,265 (GRCm39) missense probably damaging 0.97
R7968:Adamts16 UTSW 13 70,886,701 (GRCm39) missense probably benign
R8232:Adamts16 UTSW 13 70,941,217 (GRCm39) missense probably damaging 1.00
R8470:Adamts16 UTSW 13 70,984,496 (GRCm39) missense probably damaging 1.00
R8485:Adamts16 UTSW 13 70,886,794 (GRCm39) missense possibly damaging 0.89
R8772:Adamts16 UTSW 13 70,984,453 (GRCm39) missense probably damaging 1.00
R8916:Adamts16 UTSW 13 70,941,307 (GRCm39) missense probably damaging 1.00
R8921:Adamts16 UTSW 13 70,939,910 (GRCm39) splice site probably benign
R8973:Adamts16 UTSW 13 70,886,959 (GRCm39) missense probably benign 0.00
R9132:Adamts16 UTSW 13 70,901,408 (GRCm39) missense probably benign 0.39
R9149:Adamts16 UTSW 13 70,883,948 (GRCm39) missense probably damaging 1.00
R9159:Adamts16 UTSW 13 70,901,408 (GRCm39) missense probably benign 0.39
R9312:Adamts16 UTSW 13 70,949,045 (GRCm39) missense probably damaging 1.00
R9584:Adamts16 UTSW 13 70,949,136 (GRCm39) missense probably damaging 1.00
Z1176:Adamts16 UTSW 13 70,909,892 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCTGGTTTTCAAACACCAGTG -3'
(R):5'- CTTGGGCACTCAAAGACAGC -3'

Sequencing Primer
(F):5'- CTGGTTTTCAAACACCAGTGTAAGAG -3'
(R):5'- GGGCACTCAAAGACAGCTTGAATAAC -3'
Posted On 2020-07-13