Mutagenetix > Incidental Mutation

Incidental Mutation 'R8231:Thbs4'

637158

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

067663-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8231 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 92774844 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 277 (V277E)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably benign
Transcript: ENSMUST00000022213
AA Change: V277E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: V277E

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.4%
20x: 98.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 39 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,219,027	Y1687H	probably benign	Het
4930548H24Rik	T	A	5: 31,486,207	C94S	probably benign	Het
Abcg8	C	T	17: 84,692,785	R258C	probably damaging	Het
Acsf2	C	G	11: 94,561,362	E451D	probably benign	Het
Adam34	A	T	8: 43,651,622	S329T	probably benign	Het
Adamts16	A	G	13: 70,777,480	I535T	probably damaging	Het
Atp6v0d2	A	G	4: 19,881,451	F214S	probably damaging	Het
Btg4	A	G	9: 51,116,568	T13A	possibly damaging	Het
Csmd1	A	T	8: 16,697,923	S271T	possibly damaging	Het
Cul9	T	C	17: 46,520,501	T1596A	probably damaging	Het
Cyp2a4	G	A	7: 26,312,937	D382N	probably benign	Het
Dbh	C	T	2: 27,170,543	R244C	probably benign	Het
Dnajc2	T	C	5: 21,761,691	K426R	probably benign	Het
Dock4	T	A	12: 40,702,951	M428K	possibly damaging	Het
Duox2	A	T	2: 122,289,563	M822K	possibly damaging	Het
E330009J07Rik	A	T	6: 40,418,612	H187Q	probably benign	Het
Golga5	T	C	12: 102,472,299	V91A	probably benign	Het
Gpatch2l	T	C	12: 86,244,189	S49P	probably damaging	Het
Ints7	T	A	1: 191,596,353	L246*	probably null	Het
Kntc1	A	G	5: 123,782,896	T926A	possibly damaging	Het
Kyat1	T	C	2: 30,191,966	T54A	probably benign	Het
Megf6	C	G	4: 154,252,518	C359W	probably damaging	Het
Mlh3	A	G	12: 85,260,798		probably null	Het
Neb	C	A	2: 52,235,479		probably null	Het
Nyap2	A	T	1: 81,192,131	Q201L	probably benign	Het
Pibf1	T	G	14: 99,186,561	H523Q	probably benign	Het
Piezo1	A	G	8: 122,506,097	S133P		Het
Pnmal2	T	C	7: 16,946,590	C500R	probably benign	Het
Ptpra	A	G	2: 130,537,603	N359S	probably damaging	Het
Rce1	A	T	19: 4,625,050	I112N	probably damaging	Het
Rmdn1	T	C	4: 19,586,853	Y104H	probably benign	Het
Snx22	A	T	9: 66,068,198	D96E	probably benign	Het
Sox5	G	T	6: 144,028,288	Q245K	probably damaging	Het
Stat6	A	G	10: 127,646,973	D21G	possibly damaging	Het
Tbc1d15	T	C	10: 115,229,140	Y180C	probably damaging	Het
Tdrd6	T	C	17: 43,622,135	T2058A	probably damaging	Het
Tmem255b	A	G	8: 13,454,225	D139G	probably damaging	Het
Ttc27	C	A	17: 74,717,964	T18K	probably benign	Het
Zfp131	A	G	13: 119,775,812	F337L	probably damaging	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0087:Thbs4	UTSW	13	92755235	missense	probably damaging	0.99
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGGCTTCTTGGTCCACAG -3'
(R):5'- CCTCTGGAAGTTCTGCACAAG -3'

Sequencing Primer
(F):5'- CTTCTTGGTCCACAGTGGCAAG -3'
(R):5'- CTCTGGAAGTTCTGCACAAGAGTTG -3'

Posted On

2020-07-13