Incidental Mutation 'R8231:Zfp131'
ID637159
Institutional Source Beutler Lab
Gene Symbol Zfp131
Ensembl Gene ENSMUSG00000094870
Gene Namezinc finger protein 131
Synonyms2610109I01Rik, Znf131
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.957) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location119765187-119790889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 119775812 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 337 (F337L)
Ref Sequence ENSEMBL: ENSMUSP00000136867 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000177916] [ENSMUST00000178271]
Predicted Effect probably damaging
Transcript: ENSMUST00000177916
AA Change: F337L

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000136867
Gene: ENSMUSG00000094870
AA Change: F337L

DomainStartEndE-ValueType
BTB 34 129 4.83e-23 SMART
low complexity region 205 216 N/A INTRINSIC
ZnF_C2H2 261 283 6.23e-2 SMART
ZnF_C2H2 288 311 2.02e-1 SMART
ZnF_C2H2 328 350 4.11e-2 SMART
ZnF_C2H2 356 376 1.09e2 SMART
ZnF_C2H2 392 414 8.47e-4 SMART
ZnF_C2H2 420 443 1.14e0 SMART
low complexity region 532 548 N/A INTRINSIC
low complexity region 581 593 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000178271
AA Change: F303L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000136019
Gene: ENSMUSG00000094870
AA Change: F303L

DomainStartEndE-ValueType
BTB 34 129 4.83e-23 SMART
low complexity region 205 216 N/A INTRINSIC
ZnF_C2H2 254 277 2.02e-1 SMART
ZnF_C2H2 294 316 4.11e-2 SMART
ZnF_C2H2 322 342 1.09e2 SMART
ZnF_C2H2 358 380 8.47e-4 SMART
ZnF_C2H2 386 409 1.14e0 SMART
low complexity region 498 514 N/A INTRINSIC
low complexity region 547 559 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the BTB/POZ family of transcription factors. This protein has been found to act as a transcriptional activator and may regulate estrogen receptor signaling. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Other mutations in Zfp131
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1444:Zfp131 UTSW 13 119790248 missense probably damaging 0.99
R1604:Zfp131 UTSW 13 119768780 missense probably damaging 1.00
R1605:Zfp131 UTSW 13 119768780 missense probably damaging 1.00
R1712:Zfp131 UTSW 13 119766543 missense probably benign 0.00
R1899:Zfp131 UTSW 13 119767025 missense probably damaging 0.99
R2207:Zfp131 UTSW 13 119775812 missense probably damaging 1.00
R4227:Zfp131 UTSW 13 119766746 missense probably damaging 1.00
R4342:Zfp131 UTSW 13 119776018 missense probably damaging 0.99
R4852:Zfp131 UTSW 13 119788858 critical splice donor site probably null
R4876:Zfp131 UTSW 13 119788955 missense possibly damaging 0.88
R4990:Zfp131 UTSW 13 119782913 missense probably damaging 1.00
R5979:Zfp131 UTSW 13 119776446 missense probably benign 0.03
R6090:Zfp131 UTSW 13 119775996 missense probably damaging 0.99
R6269:Zfp131 UTSW 13 119766405 missense possibly damaging 0.86
R6791:Zfp131 UTSW 13 119766593 missense probably damaging 0.98
R7147:Zfp131 UTSW 13 119766543 missense probably benign 0.00
R7217:Zfp131 UTSW 13 119775841 missense probably damaging 0.99
R7809:Zfp131 UTSW 13 119788910 missense probably damaging 1.00
R7815:Zfp131 UTSW 13 119775980 missense probably damaging 0.99
R8308:Zfp131 UTSW 13 119782904 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GAGGATTATAAATGTATGCCCCTTC -3'
(R):5'- GTTCCATTGTGAGAAATGTAACCG -3'

Sequencing Primer
(F):5'- GGTTGACACTGATTTCCATTTAAAGC -3'
(R):5'- TTTAAGGAACACATGAAATCACACTC -3'
Posted On2020-07-13