Incidental Mutation 'R8231:Pibf1'
ID637160
Institutional Source Beutler Lab
Gene Symbol Pibf1
Ensembl Gene ENSMUSG00000022064
Gene Nameprogesterone immunomodulatory binding factor 1
Synonyms1700017E21Rik, 4933438D16Rik, 4933439E17Rik, D14Ertd581e, 4930513H15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location99099424-99254493 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 99186561 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 523 (H523Q)
Ref Sequence ENSEMBL: ENSMUSP00000022650 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022650]
Predicted Effect probably benign
Transcript: ENSMUST00000022650
AA Change: H523Q

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000022650
Gene: ENSMUSG00000022064
AA Change: H523Q

DomainStartEndE-ValueType
low complexity region 14 26 N/A INTRINSIC
coiled coil region 58 165 N/A INTRINSIC
coiled coil region 200 364 N/A INTRINSIC
coiled coil region 396 444 N/A INTRINSIC
coiled coil region 474 553 N/A INTRINSIC
coiled coil region 586 679 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in Pibf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Pibf1 APN 14 99179449 nonsense probably null
IGL01649:Pibf1 APN 14 99187763 missense possibly damaging 0.88
IGL01817:Pibf1 APN 14 99186472 splice site probably benign
IGL02322:Pibf1 APN 14 99210983 missense probably damaging 1.00
IGL03180:Pibf1 APN 14 99133344 missense probably benign 0.14
IGL03269:Pibf1 APN 14 99187735 missense probably damaging 0.98
IGL03354:Pibf1 APN 14 99150738 missense probably benign 0.13
R0053:Pibf1 UTSW 14 99140557 missense probably damaging 1.00
R0969:Pibf1 UTSW 14 99196386 missense probably benign 0.02
R0981:Pibf1 UTSW 14 99150743 critical splice donor site probably null
R1110:Pibf1 UTSW 14 99112973 missense probably damaging 0.99
R1205:Pibf1 UTSW 14 99101203 missense probably damaging 1.00
R1356:Pibf1 UTSW 14 99137196 missense possibly damaging 0.91
R1432:Pibf1 UTSW 14 99112989 missense probably benign 0.14
R1622:Pibf1 UTSW 14 99186481 missense probably benign 0.34
R1912:Pibf1 UTSW 14 99187809 critical splice donor site probably null
R2393:Pibf1 UTSW 14 99242932 missense probably benign 0.07
R3847:Pibf1 UTSW 14 99137121 missense possibly damaging 0.57
R4028:Pibf1 UTSW 14 99179341 missense probably damaging 0.99
R4673:Pibf1 UTSW 14 99133351 missense possibly damaging 0.93
R4857:Pibf1 UTSW 14 99186501 nonsense probably null
R4874:Pibf1 UTSW 14 99140556 missense probably damaging 1.00
R4992:Pibf1 UTSW 14 99150667 missense probably damaging 0.98
R5330:Pibf1 UTSW 14 99140646 missense probably damaging 1.00
R5543:Pibf1 UTSW 14 99112992 missense probably benign 0.38
R5582:Pibf1 UTSW 14 99137130 missense possibly damaging 0.64
R5922:Pibf1 UTSW 14 99137088 missense probably benign
R6088:Pibf1 UTSW 14 99179358 missense probably benign 0.01
R6169:Pibf1 UTSW 14 99113007 missense probably null 0.96
R6226:Pibf1 UTSW 14 99101119 missense probably damaging 1.00
R6232:Pibf1 UTSW 14 99186578 missense probably benign 0.16
R6339:Pibf1 UTSW 14 99107398 missense probably damaging 0.97
R6450:Pibf1 UTSW 14 99137210 missense probably damaging 1.00
R6828:Pibf1 UTSW 14 99186551 missense probably benign 0.31
R7185:Pibf1 UTSW 14 99107316 missense possibly damaging 0.80
R7201:Pibf1 UTSW 14 99196408 missense probably damaging 0.99
R7984:Pibf1 UTSW 14 99221627 missense probably damaging 1.00
R8125:Pibf1 UTSW 14 99179367 nonsense probably null
R8157:Pibf1 UTSW 14 99196395 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TTCAGAGATCTCCGCACCAC -3'
(R):5'- AGCAATGATTCCACCTTTCCTTTGTAG -3'

Sequencing Primer
(F):5'- CACCACCGTGTGTGTGTG -3'
(R):5'- ACGAATTTCTGAGGCCAGC -3'
Posted On2020-07-13