Incidental Mutation 'R8231:Tdrd6'
ID637162
Institutional Source Beutler Lab
Gene Symbol Tdrd6
Ensembl Gene ENSMUSG00000040140
Gene Nametudor domain containing 6
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location43615335-43630299 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 43622135 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 2058 (T2058A)
Ref Sequence ENSEMBL: ENSMUSP00000131277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045717] [ENSMUST00000168073]
Predicted Effect probably damaging
Transcript: ENSMUST00000045717
AA Change: T2057A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035338
Gene: ENSMUSG00000040140
AA Change: T2057A

DomainStartEndE-ValueType
Pfam:TUDOR 14 133 9.9e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2026 2083 9.45e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000168073
AA Change: T2058A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131277
Gene: ENSMUSG00000040140
AA Change: T2058A

DomainStartEndE-ValueType
Pfam:TUDOR 12 133 7.2e-9 PFAM
low complexity region 166 187 N/A INTRINSIC
TUDOR 308 366 1.14e-2 SMART
low complexity region 452 463 N/A INTRINSIC
TUDOR 541 597 2.68e-8 SMART
TUDOR 817 877 2.56e-5 SMART
TUDOR 1037 1090 5.36e-8 SMART
TUDOR 1357 1415 2.19e-13 SMART
TUDOR 1569 1628 3.1e-13 SMART
low complexity region 1826 1842 N/A INTRINSIC
low complexity region 1866 1876 N/A INTRINSIC
TUDOR 2027 2084 9.45e-1 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tudor domain-containing protein and component of the chromatoid body, a type of ribonucleoprotein granule present in male germ cells. Studies in rodents have demonstrated a role for the encoded protein in spermiogenesis and the nonsense mediated decay (NMD) pathway. This protein is a major autoantigen in human patients with autoimmune polyendocrine syndrome type 1 (APS1). [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit male fertility associated with arrested spermatogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cul9 T C 17: 46,520,501 T1596A probably damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in Tdrd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tdrd6 APN 17 43628160 missense probably damaging 0.96
IGL00844:Tdrd6 APN 17 43617196 missense probably benign
IGL00845:Tdrd6 APN 17 43626716 missense probably benign 0.06
IGL01558:Tdrd6 APN 17 43625768 missense probably damaging 1.00
IGL01558:Tdrd6 APN 17 43624766 missense probably benign 0.02
IGL01575:Tdrd6 APN 17 43627980 missense probably benign 0.00
IGL01812:Tdrd6 APN 17 43625174 missense probably benign 0.10
IGL02013:Tdrd6 APN 17 43625946 missense probably benign 0.00
IGL02067:Tdrd6 APN 17 43628209 missense probably damaging 1.00
IGL02112:Tdrd6 APN 17 43629351 missense probably damaging 1.00
IGL02159:Tdrd6 APN 17 43628390 missense probably damaging 1.00
IGL02226:Tdrd6 APN 17 43627202 missense probably damaging 1.00
IGL02416:Tdrd6 APN 17 43624738 missense probably benign 0.39
IGL02577:Tdrd6 APN 17 43626837 missense probably damaging 0.99
IGL02631:Tdrd6 APN 17 43626219 missense probably damaging 1.00
IGL02738:Tdrd6 APN 17 43620446 missense probably benign 0.06
IGL02792:Tdrd6 APN 17 43625027 missense probably benign
IGL02929:Tdrd6 APN 17 43629713 missense possibly damaging 0.61
IGL02934:Tdrd6 APN 17 43627887 missense probably benign 0.42
IGL02954:Tdrd6 APN 17 43627262 missense possibly damaging 0.82
IGL02969:Tdrd6 APN 17 43627549 missense probably damaging 0.98
IGL03006:Tdrd6 APN 17 43625432 missense probably damaging 1.00
IGL03155:Tdrd6 APN 17 43625507 missense probably damaging 1.00
IGL03219:Tdrd6 APN 17 43627964 missense probably benign 0.04
IGL03372:Tdrd6 APN 17 43625568 missense probably damaging 1.00
BB001:Tdrd6 UTSW 17 43627806 missense possibly damaging 0.94
BB011:Tdrd6 UTSW 17 43627806 missense possibly damaging 0.94
R0030:Tdrd6 UTSW 17 43626591 missense possibly damaging 0.80
R0057:Tdrd6 UTSW 17 43617161 splice site probably benign
R0090:Tdrd6 UTSW 17 43628241 missense probably benign 0.00
R0270:Tdrd6 UTSW 17 43624308 missense probably benign
R0463:Tdrd6 UTSW 17 43625561 missense probably damaging 1.00
R0594:Tdrd6 UTSW 17 43629383 missense probably damaging 1.00
R0650:Tdrd6 UTSW 17 43628159 missense probably damaging 0.99
R1226:Tdrd6 UTSW 17 43626632 missense possibly damaging 0.63
R1309:Tdrd6 UTSW 17 43626621 missense probably benign
R1483:Tdrd6 UTSW 17 43627607 missense probably benign 0.31
R1561:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1574:Tdrd6 UTSW 17 43625624 missense probably damaging 0.96
R1647:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1648:Tdrd6 UTSW 17 43627109 missense possibly damaging 0.49
R1723:Tdrd6 UTSW 17 43628327 missense possibly damaging 0.94
R1786:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R1819:Tdrd6 UTSW 17 43626551 missense probably benign 0.00
R1836:Tdrd6 UTSW 17 43625589 missense probably benign 0.03
R1892:Tdrd6 UTSW 17 43624805 missense probably benign 0.00
R1911:Tdrd6 UTSW 17 43627088 missense probably benign 0.21
R1936:Tdrd6 UTSW 17 43626467 missense probably damaging 0.98
R2005:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2006:Tdrd6 UTSW 17 43628655 missense probably damaging 1.00
R2132:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R2133:Tdrd6 UTSW 17 43624833 missense probably benign 0.01
R3010:Tdrd6 UTSW 17 43628042 missense probably benign 0.00
R4225:Tdrd6 UTSW 17 43625973 missense probably damaging 1.00
R4448:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4449:Tdrd6 UTSW 17 43629735 missense probably benign 0.26
R4531:Tdrd6 UTSW 17 43628754 missense probably damaging 0.98
R4624:Tdrd6 UTSW 17 43625990 missense probably damaging 0.99
R4665:Tdrd6 UTSW 17 43624116 missense probably benign
R4676:Tdrd6 UTSW 17 43627610 missense probably damaging 0.96
R4785:Tdrd6 UTSW 17 43625576 missense probably damaging 1.00
R4912:Tdrd6 UTSW 17 43624327 missense probably benign 0.34
R5134:Tdrd6 UTSW 17 43626210 missense probably damaging 1.00
R5145:Tdrd6 UTSW 17 43626075 missense probably damaging 0.96
R5623:Tdrd6 UTSW 17 43629333 missense probably damaging 1.00
R5712:Tdrd6 UTSW 17 43626408 missense probably damaging 1.00
R5897:Tdrd6 UTSW 17 43624877 missense probably damaging 0.98
R5913:Tdrd6 UTSW 17 43628411 missense possibly damaging 0.73
R6142:Tdrd6 UTSW 17 43629482 missense probably benign 0.01
R6181:Tdrd6 UTSW 17 43628897 missense probably damaging 1.00
R6195:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6233:Tdrd6 UTSW 17 43629752 missense probably damaging 1.00
R6289:Tdrd6 UTSW 17 43624520 missense probably benign 0.01
R6315:Tdrd6 UTSW 17 43626338 missense probably benign 0.02
R6578:Tdrd6 UTSW 17 43628961 missense possibly damaging 0.65
R6645:Tdrd6 UTSW 17 43624532 missense probably benign 0.10
R6822:Tdrd6 UTSW 17 43627215 missense probably damaging 1.00
R7000:Tdrd6 UTSW 17 43627708 missense probably benign 0.28
R7075:Tdrd6 UTSW 17 43625174 missense probably benign 0.10
R7107:Tdrd6 UTSW 17 43624204 missense probably benign 0.00
R7381:Tdrd6 UTSW 17 43626093 missense probably benign 0.00
R7458:Tdrd6 UTSW 17 43625046 missense probably benign 0.02
R7461:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7505:Tdrd6 UTSW 17 43627679 missense not run
R7583:Tdrd6 UTSW 17 43624238 missense probably benign 0.29
R7613:Tdrd6 UTSW 17 43627926 missense probably benign 0.00
R7723:Tdrd6 UTSW 17 43625960 missense probably benign 0.09
R7759:Tdrd6 UTSW 17 43624839 missense probably benign 0.00
R7924:Tdrd6 UTSW 17 43627806 missense possibly damaging 0.94
R8002:Tdrd6 UTSW 17 43629819 missense probably damaging 0.98
R8134:Tdrd6 UTSW 17 43626173 missense probably damaging 0.99
R8242:Tdrd6 UTSW 17 43628930 missense probably damaging 1.00
X0065:Tdrd6 UTSW 17 43625153 missense possibly damaging 0.80
X0065:Tdrd6 UTSW 17 43625993 missense probably damaging 0.99
Z1088:Tdrd6 UTSW 17 43626518 missense probably benign 0.23
Z1177:Tdrd6 UTSW 17 43627187 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTCCCACCAGTTGTTCAC -3'
(R):5'- CAAGCAGAGTTAGTGAACTTTGAAC -3'

Sequencing Primer
(F):5'- CCACCAGTTGTTCACATTAAAAAGTG -3'
(R):5'- AACTTTGTGTCTCGTGCTAACAG -3'
Posted On2020-07-13