Incidental Mutation 'R8231:Cul9'
ID637163
Institutional Source Beutler Lab
Gene Symbol Cul9
Ensembl Gene ENSMUSG00000040327
Gene Namecullin 9
Synonyms1810035I07Rik, Parc
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.334) question?
Stock #R8231 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46500572-46546388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46520501 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1596 (T1596A)
Ref Sequence ENSEMBL: ENSMUSP00000138418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066026] [ENSMUST00000182485]
Predicted Effect possibly damaging
Transcript: ENSMUST00000066026
AA Change: T1596A

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067736
Gene: ENSMUSG00000040327
AA Change: T1596A

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 441 1e-35 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 2e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
low complexity region 2503 2520 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182485
AA Change: T1596A

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138418
Gene: ENSMUSG00000040327
AA Change: T1596A

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 345 357 N/A INTRINSIC
Pfam:Cul7 367 442 1.4e-33 PFAM
low complexity region 447 460 N/A INTRINSIC
low complexity region 525 540 N/A INTRINSIC
low complexity region 845 860 N/A INTRINSIC
low complexity region 873 880 N/A INTRINSIC
APC10 1166 1325 1.97e-56 SMART
low complexity region 1437 1450 N/A INTRINSIC
low complexity region 1563 1578 N/A INTRINSIC
low complexity region 1646 1671 N/A INTRINSIC
Cullin_Nedd8 1867 1950 7.55e-6 SMART
Blast:RING 2074 2122 3e-13 BLAST
IBR 2144 2207 8.99e-14 SMART
IBR 2228 2283 4.66e-2 SMART
coiled coil region 2461 2497 N/A INTRINSIC
low complexity region 2513 2530 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight, increased incidence of tumors, and decreased cellular sensitivity to radiation-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,219,027 Y1687H probably benign Het
4930548H24Rik T A 5: 31,486,207 C94S probably benign Het
Abcg8 C T 17: 84,692,785 R258C probably damaging Het
Acsf2 C G 11: 94,561,362 E451D probably benign Het
Adam34 A T 8: 43,651,622 S329T probably benign Het
Adamts16 A G 13: 70,777,480 I535T probably damaging Het
Atp6v0d2 A G 4: 19,881,451 F214S probably damaging Het
Btg4 A G 9: 51,116,568 T13A possibly damaging Het
Csmd1 A T 8: 16,697,923 S271T possibly damaging Het
Cyp2a4 G A 7: 26,312,937 D382N probably benign Het
Dbh C T 2: 27,170,543 R244C probably benign Het
Dnajc2 T C 5: 21,761,691 K426R probably benign Het
Dock4 T A 12: 40,702,951 M428K possibly damaging Het
Duox2 A T 2: 122,289,563 M822K possibly damaging Het
E330009J07Rik A T 6: 40,418,612 H187Q probably benign Het
Golga5 T C 12: 102,472,299 V91A probably benign Het
Gpatch2l T C 12: 86,244,189 S49P probably damaging Het
Ints7 T A 1: 191,596,353 L246* probably null Het
Kntc1 A G 5: 123,782,896 T926A possibly damaging Het
Kyat1 T C 2: 30,191,966 T54A probably benign Het
Megf6 C G 4: 154,252,518 C359W probably damaging Het
Mlh3 A G 12: 85,260,798 probably null Het
Neb C A 2: 52,235,479 probably null Het
Nyap2 A T 1: 81,192,131 Q201L probably benign Het
Pibf1 T G 14: 99,186,561 H523Q probably benign Het
Piezo1 A G 8: 122,506,097 S133P Het
Pnmal2 T C 7: 16,946,590 C500R probably benign Het
Ptpra A G 2: 130,537,603 N359S probably damaging Het
Rce1 A T 19: 4,625,050 I112N probably damaging Het
Rmdn1 T C 4: 19,586,853 Y104H probably benign Het
Snx22 A T 9: 66,068,198 D96E probably benign Het
Sox5 G T 6: 144,028,288 Q245K probably damaging Het
Stat6 A G 10: 127,646,973 D21G possibly damaging Het
Tbc1d15 T C 10: 115,229,140 Y180C probably damaging Het
Tdrd6 T C 17: 43,622,135 T2058A probably damaging Het
Thbs4 A T 13: 92,774,844 V277E probably benign Het
Tmem255b A G 8: 13,454,225 D139G probably damaging Het
Ttc27 C A 17: 74,717,964 T18K probably benign Het
Zfp131 A G 13: 119,775,812 F337L probably damaging Het
Other mutations in Cul9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Cul9 APN 17 46525709 missense probably damaging 1.00
IGL00330:Cul9 APN 17 46510841 splice site probably benign
IGL00726:Cul9 APN 17 46528096 missense probably damaging 1.00
IGL01020:Cul9 APN 17 46539023 missense probably damaging 1.00
IGL01358:Cul9 APN 17 46538314 missense probably damaging 1.00
IGL01410:Cul9 APN 17 46528646 missense probably damaging 0.99
IGL01781:Cul9 APN 17 46539304 missense probably benign
IGL01873:Cul9 APN 17 46502452 missense probably damaging 0.99
IGL02117:Cul9 APN 17 46540375 missense probably benign 0.00
IGL02300:Cul9 APN 17 46521032 splice site probably benign
IGL02426:Cul9 APN 17 46523258 missense possibly damaging 0.95
IGL02427:Cul9 APN 17 46502632 missense possibly damaging 0.69
IGL02496:Cul9 APN 17 46540376 missense possibly damaging 0.72
IGL03008:Cul9 APN 17 46502697 splice site probably benign
IGL03059:Cul9 APN 17 46538987 missense probably damaging 0.98
IGL03302:Cul9 APN 17 46526640 missense probably damaging 0.98
bottlenose UTSW 17 46500844 missense possibly damaging 0.79
flipper UTSW 17 46525892 missense probably benign 0.05
orca UTSW 17 46525135 missense probably damaging 1.00
FR4340:Cul9 UTSW 17 46500853 small insertion probably benign
FR4449:Cul9 UTSW 17 46500856 small insertion probably benign
FR4737:Cul9 UTSW 17 46500846 small insertion probably benign
FR4737:Cul9 UTSW 17 46500858 small insertion probably benign
FR4976:Cul9 UTSW 17 46500848 small insertion probably benign
FR4976:Cul9 UTSW 17 46500850 small insertion probably benign
FR4976:Cul9 UTSW 17 46500853 small insertion probably benign
FR4976:Cul9 UTSW 17 46500856 small insertion probably benign
R0012:Cul9 UTSW 17 46538510 missense probably benign 0.26
R0079:Cul9 UTSW 17 46537663 nonsense probably null
R0143:Cul9 UTSW 17 46526410 missense possibly damaging 0.65
R0390:Cul9 UTSW 17 46528589 missense probably benign 0.34
R0401:Cul9 UTSW 17 46541704 missense probably damaging 1.00
R0529:Cul9 UTSW 17 46520468 splice site probably benign
R0815:Cul9 UTSW 17 46537822 splice site probably null
R0863:Cul9 UTSW 17 46537822 splice site probably null
R0972:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1173:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1216:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1217:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1261:Cul9 UTSW 17 46525782 missense probably damaging 1.00
R1278:Cul9 UTSW 17 46500849 small deletion probably benign
R1281:Cul9 UTSW 17 46511534 missense probably damaging 1.00
R1349:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1372:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1403:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1405:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1405:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1467:Cul9 UTSW 17 46525373 missense probably damaging 1.00
R1482:Cul9 UTSW 17 46508547 missense probably damaging 0.99
R1491:Cul9 UTSW 17 46538564 nonsense probably null
R1618:Cul9 UTSW 17 46525892 missense probably benign 0.05
R1641:Cul9 UTSW 17 46543560 missense possibly damaging 0.96
R1679:Cul9 UTSW 17 46521156 missense possibly damaging 0.90
R1771:Cul9 UTSW 17 46537812 missense probably benign 0.41
R1803:Cul9 UTSW 17 46503097 missense probably damaging 1.00
R2020:Cul9 UTSW 17 46522175 missense probably damaging 1.00
R2046:Cul9 UTSW 17 46543733 missense probably damaging 1.00
R2056:Cul9 UTSW 17 46543372 missense probably benign
R2088:Cul9 UTSW 17 46526649 missense probably damaging 1.00
R2415:Cul9 UTSW 17 46543438 missense probably benign
R2925:Cul9 UTSW 17 46510981 missense probably benign 0.08
R2964:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R2965:Cul9 UTSW 17 46502228 missense probably damaging 0.96
R3690:Cul9 UTSW 17 46504031 splice site probably null
R3847:Cul9 UTSW 17 46525135 missense probably damaging 1.00
R4437:Cul9 UTSW 17 46502159 missense probably damaging 1.00
R4470:Cul9 UTSW 17 46538336 missense probably benign 0.00
R4540:Cul9 UTSW 17 46503089 missense probably null 0.98
R4555:Cul9 UTSW 17 46501829 missense possibly damaging 0.82
R4604:Cul9 UTSW 17 46530146 missense probably damaging 0.99
R4646:Cul9 UTSW 17 46539017 nonsense probably null
R4799:Cul9 UTSW 17 46500844 missense possibly damaging 0.79
R4822:Cul9 UTSW 17 46530051 missense probably benign 0.01
R4964:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R4965:Cul9 UTSW 17 46538525 missense probably damaging 1.00
R5027:Cul9 UTSW 17 46500782 missense probably damaging 0.99
R5185:Cul9 UTSW 17 46525832 missense possibly damaging 0.95
R5237:Cul9 UTSW 17 46543467 missense probably benign 0.00
R5278:Cul9 UTSW 17 46510873 missense probably damaging 1.00
R5361:Cul9 UTSW 17 46500849 small deletion probably benign
R5455:Cul9 UTSW 17 46510846 splice site probably null
R5592:Cul9 UTSW 17 46520591 missense probably benign 0.00
R5597:Cul9 UTSW 17 46502665 missense possibly damaging 0.56
R5613:Cul9 UTSW 17 46503844 missense probably damaging 1.00
R6122:Cul9 UTSW 17 46521928 missense possibly damaging 0.72
R6135:Cul9 UTSW 17 46521453 missense probably benign
R6352:Cul9 UTSW 17 46511315 missense probably benign 0.00
R6376:Cul9 UTSW 17 46508563 missense probably damaging 1.00
R6868:Cul9 UTSW 17 46522183 missense possibly damaging 0.73
R6898:Cul9 UTSW 17 46511026 missense possibly damaging 0.87
R7090:Cul9 UTSW 17 46500839 missense probably damaging 0.96
R7193:Cul9 UTSW 17 46538497 missense probably damaging 0.98
R7221:Cul9 UTSW 17 46528565 missense probably damaging 0.99
R7291:Cul9 UTSW 17 46540433 missense probably benign 0.00
R7320:Cul9 UTSW 17 46510909 missense possibly damaging 0.80
R7348:Cul9 UTSW 17 46510993 missense possibly damaging 0.89
R7463:Cul9 UTSW 17 46520476 splice site probably null
R7480:Cul9 UTSW 17 46537812 missense probably benign 0.41
R7573:Cul9 UTSW 17 46519910 missense probably benign
R7582:Cul9 UTSW 17 46510979 missense probably damaging 1.00
R7605:Cul9 UTSW 17 46541732 missense probably damaging 0.99
R7684:Cul9 UTSW 17 46509889 missense probably damaging 1.00
R7830:Cul9 UTSW 17 46540311 missense probably benign 0.37
R7834:Cul9 UTSW 17 46525704 splice site probably null
R8131:Cul9 UTSW 17 46511242 missense probably damaging 1.00
R8192:Cul9 UTSW 17 46538347 missense probably benign 0.01
R8248:Cul9 UTSW 17 46530014 missense probably damaging 0.99
R8504:Cul9 UTSW 17 46503580 missense probably damaging 1.00
RF011:Cul9 UTSW 17 46500848 small insertion probably benign
RF016:Cul9 UTSW 17 46500863 nonsense probably null
RF026:Cul9 UTSW 17 46500869 nonsense probably null
RF027:Cul9 UTSW 17 46500848 small insertion probably benign
RF030:Cul9 UTSW 17 46500869 small insertion probably benign
RF033:Cul9 UTSW 17 46500854 small insertion probably benign
RF039:Cul9 UTSW 17 46500854 small insertion probably benign
RF041:Cul9 UTSW 17 46500854 nonsense probably null
RF042:Cul9 UTSW 17 46540615 frame shift probably null
RF057:Cul9 UTSW 17 46500863 nonsense probably null
Z1176:Cul9 UTSW 17 46520576 nonsense probably null
Z1176:Cul9 UTSW 17 46520585 nonsense probably null
Z1177:Cul9 UTSW 17 46537797 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCAGCCATGTAATGCCTGCAG -3'
(R):5'- ACGCTGCTTGTCTGAATCC -3'

Sequencing Primer
(F):5'- CTCCTCCTAAAGGTGAGTCTGTG -3'
(R):5'- CCATTCCGTTGTCCCCAGATAAG -3'
Posted On2020-07-13