Incidental Mutation 'R8232:Adamts16'
ID 637190
Institutional Source Beutler Lab
Gene Symbol Adamts16
Ensembl Gene ENSMUSG00000049538
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 16
Synonyms
MMRRC Submission 067664-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8232 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 70875921-70989930 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70941217 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 390 (C390F)
Ref Sequence ENSEMBL: ENSMUSP00000079041 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080145] [ENSMUST00000109694] [ENSMUST00000123552]
AlphaFold Q69Z28
Predicted Effect probably damaging
Transcript: ENSMUST00000080145
AA Change: C390F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079041
Gene: ENSMUSG00000049538
AA Change: C390F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 57 203 7.8e-34 PFAM
Pfam:Reprolysin_5 287 470 2.9e-13 PFAM
Pfam:Reprolysin_4 289 489 1.2e-8 PFAM
Pfam:Reprolysin 289 493 5.4e-32 PFAM
Pfam:Reprolysin_2 306 483 3.7e-10 PFAM
Pfam:Reprolysin_3 310 442 6.4e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
TSP1 872 926 3.48e0 SMART
TSP1 928 985 4.84e-3 SMART
TSP1 987 1046 1.49e-3 SMART
TSP1 1052 1113 3.19e-2 SMART
TSP1 1127 1179 7.68e-6 SMART
Pfam:PLAC 1188 1218 2.9e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109694
AA Change: C390F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105316
Gene: ENSMUSG00000049538
AA Change: C390F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 2.2e-32 PFAM
Pfam:Reprolysin_5 287 470 1.8e-13 PFAM
Pfam:Reprolysin_4 289 489 7.3e-9 PFAM
Pfam:Reprolysin 289 493 4.6e-33 PFAM
Pfam:Reprolysin_2 306 483 4.1e-10 PFAM
Pfam:Reprolysin_3 310 442 3.3e-10 PFAM
TSP1 587 639 1.43e-14 SMART
Pfam:ADAM_spacer1 744 856 1.3e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123552
AA Change: C390F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122031
Gene: ENSMUSG00000049538
AA Change: C390F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 26 36 N/A INTRINSIC
Pfam:Pep_M12B_propep 56 203 5.9e-33 PFAM
Pfam:Reprolysin_5 287 470 5.1e-14 PFAM
Pfam:Reprolysin_4 289 489 2.2e-9 PFAM
Pfam:Reprolysin 289 493 1.2e-33 PFAM
Pfam:Reprolysin_2 306 483 1.2e-10 PFAM
Pfam:Reprolysin_3 310 442 9.7e-11 PFAM
TSP1 587 639 1.43e-14 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.4%
  • 20x: 98.5%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is co-expressed with the Wilms tumor protein, Wt1, in the developing glomeruli of embryonic kidneys. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acnat1 A T 4: 49,450,817 (GRCm39) M98K probably damaging Het
Actn3 A T 19: 4,921,683 (GRCm39) W166R probably damaging Het
Arhgap32 A T 9: 32,168,198 (GRCm39) D727V probably damaging Het
Bcr A G 10: 75,001,883 (GRCm39) Y929C probably damaging Het
Bmp1 T A 14: 70,757,329 (GRCm39) Y50F probably damaging Het
Camta2 G A 11: 70,573,841 (GRCm39) R171C unknown Het
Ccnd2 A G 6: 127,127,549 (GRCm39) L63P probably damaging Het
Clip1 G C 5: 123,785,981 (GRCm39) D234E probably benign Het
Dnah9 A T 11: 65,746,149 (GRCm39) I3988N possibly damaging Het
Frmpd2 T G 14: 33,261,724 (GRCm39) I843S probably damaging Het
Gcgr A G 11: 120,427,328 (GRCm39) Y146C probably damaging Het
Gm5930 T G 14: 44,573,181 (GRCm39) K158T probably damaging Het
Gnl1 T A 17: 36,298,487 (GRCm39) C410* probably null Het
Gtf2h1 T A 7: 46,451,103 (GRCm39) I4K probably benign Het
Il12b A G 11: 44,299,401 (GRCm39) S157G possibly damaging Het
Jcad G T 18: 4,674,862 (GRCm39) A875S probably benign Het
Kcnrg T A 14: 61,845,386 (GRCm39) M142K probably benign Het
Krtap4-6 A C 11: 99,556,568 (GRCm39) L53R unknown Het
Myo10 G A 15: 25,804,400 (GRCm39) G1565D possibly damaging Het
Nf1 A G 11: 79,469,157 (GRCm39) S806G probably damaging Het
Nlrp5 G T 7: 23,116,770 (GRCm39) V165L probably benign Het
Nppa T C 4: 148,085,795 (GRCm39) I134T possibly damaging Het
Or4a72 A T 2: 89,405,938 (GRCm39) V44E noncoding transcript Het
Or51ai2 G A 7: 103,586,980 (GRCm39) R131Q possibly damaging Het
Or5b107 A G 19: 13,142,683 (GRCm39) M102V probably benign Het
Or5p68 A T 7: 107,945,495 (GRCm39) M231K probably damaging Het
Or6c202 C A 10: 128,996,097 (GRCm39) C252F probably damaging Het
Scyl2 A T 10: 89,498,309 (GRCm39) F167I probably damaging Het
Smarcal1 T C 1: 72,665,722 (GRCm39) L740S probably damaging Het
Tmem183a T A 1: 134,277,918 (GRCm39) D282V probably damaging Het
Trhde A T 10: 114,636,442 (GRCm39) V255E possibly damaging Het
Vmn1r229 T A 17: 21,035,309 (GRCm39) C185S probably damaging Het
Vmn2r58 A T 7: 41,514,076 (GRCm39) M189K probably damaging Het
Vps50 T G 6: 3,600,139 (GRCm39) V866G probably damaging Het
Other mutations in Adamts16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Adamts16 APN 13 70,943,603 (GRCm39) missense probably benign 0.01
IGL01338:Adamts16 APN 13 70,984,234 (GRCm39) missense probably damaging 1.00
IGL01663:Adamts16 APN 13 70,941,260 (GRCm39) missense probably benign 0.01
IGL01804:Adamts16 APN 13 70,949,080 (GRCm39) nonsense probably null
IGL01874:Adamts16 APN 13 70,916,823 (GRCm39) missense possibly damaging 0.79
IGL01984:Adamts16 APN 13 70,935,266 (GRCm39) missense probably damaging 1.00
IGL02305:Adamts16 APN 13 70,921,048 (GRCm39) missense probably damaging 1.00
IGL02350:Adamts16 APN 13 70,886,704 (GRCm39) missense probably benign 0.00
IGL02357:Adamts16 APN 13 70,886,704 (GRCm39) missense probably benign 0.00
IGL02429:Adamts16 APN 13 70,935,289 (GRCm39) splice site probably benign
IGL02450:Adamts16 APN 13 70,984,419 (GRCm39) missense probably damaging 0.97
IGL02807:Adamts16 APN 13 70,886,897 (GRCm39) critical splice donor site probably null
IGL03356:Adamts16 APN 13 70,901,410 (GRCm39) missense probably benign 0.00
swap UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
switcheroo UTSW 13 70,949,073 (GRCm39) missense probably benign
R0046:Adamts16 UTSW 13 70,911,579 (GRCm39) missense probably benign 0.00
R0046:Adamts16 UTSW 13 70,911,579 (GRCm39) missense probably benign 0.00
R0201:Adamts16 UTSW 13 70,927,763 (GRCm39) missense possibly damaging 0.69
R0326:Adamts16 UTSW 13 70,927,730 (GRCm39) missense possibly damaging 0.89
R0336:Adamts16 UTSW 13 70,939,913 (GRCm39) critical splice donor site probably benign
R0369:Adamts16 UTSW 13 70,927,671 (GRCm39) missense possibly damaging 0.94
R0422:Adamts16 UTSW 13 70,887,074 (GRCm39) missense probably damaging 1.00
R0507:Adamts16 UTSW 13 70,916,766 (GRCm39) missense probably benign
R0524:Adamts16 UTSW 13 70,949,013 (GRCm39) missense probably benign 0.00
R0590:Adamts16 UTSW 13 70,949,073 (GRCm39) missense probably benign
R0734:Adamts16 UTSW 13 70,886,600 (GRCm39) splice site probably benign
R0787:Adamts16 UTSW 13 70,886,948 (GRCm39) missense probably damaging 1.00
R0826:Adamts16 UTSW 13 70,916,811 (GRCm39) missense possibly damaging 0.64
R0920:Adamts16 UTSW 13 70,911,680 (GRCm39) splice site probably benign
R1027:Adamts16 UTSW 13 70,915,921 (GRCm39) missense probably damaging 1.00
R1462:Adamts16 UTSW 13 70,984,253 (GRCm39) missense probably benign 0.00
R1462:Adamts16 UTSW 13 70,984,253 (GRCm39) missense probably benign 0.00
R1535:Adamts16 UTSW 13 70,939,913 (GRCm39) critical splice donor site probably null
R1617:Adamts16 UTSW 13 70,946,154 (GRCm39) missense probably benign 0.09
R1700:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1734:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1736:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1737:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1738:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R1746:Adamts16 UTSW 13 70,927,717 (GRCm39) splice site probably null
R1869:Adamts16 UTSW 13 70,883,866 (GRCm39) missense probably damaging 1.00
R1944:Adamts16 UTSW 13 70,940,005 (GRCm39) missense possibly damaging 0.93
R1997:Adamts16 UTSW 13 70,901,386 (GRCm39) missense probably benign 0.39
R2018:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R2135:Adamts16 UTSW 13 70,949,126 (GRCm39) missense probably damaging 1.00
R2219:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R2228:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R3410:Adamts16 UTSW 13 70,901,345 (GRCm39) missense probably benign 0.00
R3411:Adamts16 UTSW 13 70,901,345 (GRCm39) missense probably benign 0.00
R3842:Adamts16 UTSW 13 70,887,010 (GRCm39) missense possibly damaging 0.92
R4117:Adamts16 UTSW 13 70,916,111 (GRCm39) missense probably benign 0.01
R4435:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4436:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4526:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4552:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4555:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4556:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4557:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4579:Adamts16 UTSW 13 70,927,743 (GRCm39) missense probably damaging 1.00
R4639:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4640:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4641:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4642:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R4672:Adamts16 UTSW 13 70,927,637 (GRCm39) critical splice donor site probably benign
R5350:Adamts16 UTSW 13 70,901,315 (GRCm39) nonsense probably null
R5464:Adamts16 UTSW 13 70,909,868 (GRCm39) missense probably benign 0.01
R5613:Adamts16 UTSW 13 70,878,253 (GRCm39) missense probably benign 0.01
R5667:Adamts16 UTSW 13 70,984,494 (GRCm39) nonsense probably null
R5735:Adamts16 UTSW 13 70,984,337 (GRCm39) missense possibly damaging 0.94
R5762:Adamts16 UTSW 13 70,886,617 (GRCm39) missense probably damaging 1.00
R5907:Adamts16 UTSW 13 70,877,029 (GRCm39) missense probably damaging 1.00
R6169:Adamts16 UTSW 13 70,918,393 (GRCm39) nonsense probably null
R6351:Adamts16 UTSW 13 70,984,322 (GRCm39) missense probably damaging 1.00
R6665:Adamts16 UTSW 13 70,927,689 (GRCm39) missense probably damaging 1.00
R6913:Adamts16 UTSW 13 70,877,017 (GRCm39) missense possibly damaging 0.94
R6982:Adamts16 UTSW 13 70,916,639 (GRCm39) splice site probably null
R6996:Adamts16 UTSW 13 70,946,157 (GRCm39) critical splice acceptor site probably null
R7313:Adamts16 UTSW 13 70,921,074 (GRCm39) nonsense probably null
R7356:Adamts16 UTSW 13 70,984,399 (GRCm39) missense probably benign 0.03
R7509:Adamts16 UTSW 13 70,935,283 (GRCm39) missense probably damaging 1.00
R7595:Adamts16 UTSW 13 70,878,234 (GRCm39) missense probably damaging 1.00
R7782:Adamts16 UTSW 13 70,984,265 (GRCm39) missense probably damaging 0.97
R7968:Adamts16 UTSW 13 70,886,701 (GRCm39) missense probably benign
R8231:Adamts16 UTSW 13 70,925,599 (GRCm39) missense probably damaging 0.99
R8470:Adamts16 UTSW 13 70,984,496 (GRCm39) missense probably damaging 1.00
R8485:Adamts16 UTSW 13 70,886,794 (GRCm39) missense possibly damaging 0.89
R8772:Adamts16 UTSW 13 70,984,453 (GRCm39) missense probably damaging 1.00
R8916:Adamts16 UTSW 13 70,941,307 (GRCm39) missense probably damaging 1.00
R8921:Adamts16 UTSW 13 70,939,910 (GRCm39) splice site probably benign
R8973:Adamts16 UTSW 13 70,886,959 (GRCm39) missense probably benign 0.00
R9132:Adamts16 UTSW 13 70,901,408 (GRCm39) missense probably benign 0.39
R9149:Adamts16 UTSW 13 70,883,948 (GRCm39) missense probably damaging 1.00
R9159:Adamts16 UTSW 13 70,901,408 (GRCm39) missense probably benign 0.39
R9312:Adamts16 UTSW 13 70,949,045 (GRCm39) missense probably damaging 1.00
R9584:Adamts16 UTSW 13 70,949,136 (GRCm39) missense probably damaging 1.00
Z1176:Adamts16 UTSW 13 70,909,892 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GACAGCTTGAATCTCCCTGTC -3'
(R):5'- GCGGTAGCATGCTTTCTCTAC -3'

Sequencing Primer
(F):5'- CCGTGGCAGGAGACATG -3'
(R):5'- GGTAGCATGCTTTCTCTACATTTCTG -3'
Posted On 2020-07-13