Mutagenetix > Incidental Mutation

Incidental Mutation 'R0718:Rptor'

63720

Institutional Source

Beutler Lab

Gene Symbol

Rptor

Ensembl Gene

ENSMUSG00000025583

Gene Name

regulatory associated protein of MTOR, complex 1

Synonyms

raptor, Rap, 4932417H02Rik

MMRRC Submission

038900-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0718 (G1)

Quality Score

106

Status

Validated

Chromosome

Chromosomal Location

119602905-119899576 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119872376 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Valine at position 929 (M929V)

Ref Sequence

ENSEMBL: ENSMUSP00000026671 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026671] [ENSMUST00000131217] [ENSMUST00000147781]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000026671
AA Change: M929V

PolyPhen 2 Score 0.147 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000026671
Gene: ENSMUSG00000025583
AA Change: M929V

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART
Pfam:HEAT_2	559	668	7.9e-11	PFAM
Pfam:HEAT	602	630	1.9e-6	PFAM
low complexity region	755	772	N/A	INTRINSIC
low complexity region	877	887	N/A	INTRINSIC
low complexity region	939	945	N/A	INTRINSIC
WD40	1012	1050	2.56e1	SMART
WD40	1052	1097	4.28e0	SMART
WD40	1105	1151	1.83e2	SMART
WD40	1154	1194	1.82e-2	SMART
WD40	1200	1240	5.35e-1	SMART
WD40	1246	1281	7.13e0	SMART
WD40	1283	1329	2.67e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126802

Predicted Effect

probably benign
Transcript: ENSMUST00000131217

SMART Domains

Protein: ENSMUSP00000125667
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
low complexity region	11	28	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000136662
AA Change: M223V

SMART Domains

Protein: ENSMUSP00000125293
Gene: ENSMUSG00000025583
AA Change: M223V

Domain	Start	End	E-Value	Type
low complexity region	50	67	N/A	INTRINSIC
low complexity region	172	182	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000147781

SMART Domains

Protein: ENSMUSP00000124366
Gene: ENSMUSG00000025583

Domain	Start	End	E-Value	Type
Raptor_N	54	207	2.3e-98	SMART

Meta Mutation Damage Score

0.0945

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: This gene encodes a subunit of mammalian target of rapamycin complex 1 (mTORC1), a component of the mTOR signaling pathway, which regulates cell growth in response to nutrient and energy levels. The encoded protein may regulate the assembly, localization, and substrate binding of the mTORC1 complex. Homozygous knockout mice for this gene exhibit embryonic lethality. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutation of this gene results in lethality prior to somitogenesis. Mice homozygous for a conditional allele activated in dendritic cells exhibit increased susceptibility to induced colitis and expansion of certain populations of dendritic cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl4	A	T	3: 95,679,608	Y811N	possibly damaging	Het
Adrm1	T	C	2: 180,175,147		probably benign	Het
Alms1	T	A	6: 85,621,821	S1210T	probably benign	Het
Ampd3	C	T	7: 110,777,808	P11L	probably damaging	Het
Arhgap5	A	G	12: 52,516,507	E87G	possibly damaging	Het
Armc5	C	T	7: 128,240,070		probably benign	Het
Asic2	C	G	11: 80,971,456		probably benign	Het
Asph	A	G	4: 9,514,683		probably benign	Het
Bicd2	T	A	13: 49,377,875		probably null	Het
Brip1	A	G	11: 86,143,305	L530P	possibly damaging	Het
Bsn	G	T	9: 108,111,360		probably benign	Het
Btnl4	T	A	17: 34,469,634	H390L	probably benign	Het
Ccdc70	A	C	8: 21,973,308	K38T	probably damaging	Het
Ccni	G	A	5: 93,202,316	P35S	probably benign	Het
Cdh17	A	G	4: 11,810,451	D714G	possibly damaging	Het
Cenpf	A	G	1: 189,653,984	L2033P	probably damaging	Het
Cfap69	A	T	5: 5,621,924	M328K	probably damaging	Het
Cmah	T	G	13: 24,417,210		probably null	Het
Cog6	T	C	3: 53,010,629	T163A	probably benign	Het
Cyp2j8	G	A	4: 96,501,196	S130F	probably benign	Het
Dgki	A	G	6: 37,012,896	V636A	probably damaging	Het
Dmkn	T	A	7: 30,764,786		probably benign	Het
Dnah6	A	G	6: 73,035,293	I3679T	possibly damaging	Het
Dsp	A	T	13: 38,196,764	Y2495F	possibly damaging	Het
Exosc4	C	T	15: 76,329,489	A171V	probably benign	Het
Fbxw24	A	G	9: 109,623,509		probably benign	Het
Flvcr1	A	T	1: 191,025,582	L171Q	probably damaging	Het
Fsd1	G	T	17: 55,996,445		probably null	Het
Gm7732	A	G	17: 21,129,844		noncoding transcript	Het
H2-K2	A	C	17: 33,975,623		noncoding transcript	Het
Hgf	A	G	5: 16,593,859	N295S	probably damaging	Het
Ift88	T	A	14: 57,517,413	D811E	probably benign	Het
Igsf9b	T	A	9: 27,323,361		probably null	Het
Immt	T	A	6: 71,863,172	V311E	probably damaging	Het
Ipo11	T	A	13: 106,919,611	N51I	possibly damaging	Het
Isy1	T	C	6: 87,819,176	K260E	probably damaging	Het
Jchain	T	G	5: 88,526,202	I28L	probably benign	Het
Jmjd1c	T	A	10: 67,218,946		probably null	Het
Kif13b	T	C	14: 64,751,662		probably benign	Het
Klhdc7b	T	C	15: 89,388,169	Y427H	possibly damaging	Het
Klhl8	T	C	5: 103,876,293		probably benign	Het
Lrp2	C	T	2: 69,510,948	D963N	probably damaging	Het
Ltbp3	G	T	19: 5,746,748		probably benign	Het
Ltf	C	A	9: 111,040,379	Q41K	probably benign	Het
Med4	T	A	14: 73,516,657	I148N	probably damaging	Het
Mlh3	T	G	12: 85,247,697	S1242R	possibly damaging	Het
Mllt6	T	C	11: 97,676,359		probably benign	Het
Mpdz	A	G	4: 81,292,473	I1712T	possibly damaging	Het
Mrgprb4	T	A	7: 48,198,553	H209L	probably benign	Het
Nkapl	A	T	13: 21,468,440	M1K	probably null	Het
Nmur2	T	A	11: 56,029,498		probably benign	Het
Nsun2	T	A	13: 69,543,697		probably benign	Het
Olfr1082	G	A	2: 86,594,081	T249I	probably benign	Het
Olfr1130	A	G	2: 87,607,927	I180V	probably benign	Het
Ovgp1	T	C	3: 105,974,830		probably benign	Het
Pcdh8	A	G	14: 79,770,691	V144A	possibly damaging	Het
Pcnx3	G	A	19: 5,677,728		probably benign	Het
Pla2r1	C	A	2: 60,479,530	V570L	possibly damaging	Het
Plxnd1	C	A	6: 115,966,638	E1202D	possibly damaging	Het
Ppp1r37	T	C	7: 19,532,254	E529G	probably benign	Het
Prdm15	A	G	16: 97,812,633	F496L	possibly damaging	Het
Prlhr	A	T	19: 60,468,005	V41D	probably benign	Het
Prlhr	G	T	19: 60,468,059	S23*	probably null	Het
Prpf4	C	T	4: 62,414,540		probably benign	Het
Psg26	C	T	7: 18,475,235	R416H	probably benign	Het
Psg26	T	C	7: 18,478,287	H381R	probably benign	Het
Ralgds	T	G	2: 28,549,116	M717R	probably benign	Het
Rbms1	T	C	2: 60,842,412	N44D	probably damaging	Het
Rpa1	T	C	11: 75,318,401		probably benign	Het
Rprd2	T	C	3: 95,766,387	N568S	probably benign	Het
Rspo1	T	A	4: 125,007,149	C97S	possibly damaging	Het
Scin	C	T	12: 40,079,607	G396S	probably damaging	Het
Scn9a	T	C	2: 66,547,112	N409D	probably damaging	Het
Sf3b1	A	G	1: 55,019,385	I15T	probably damaging	Het
Sh3bp2	T	C	5: 34,555,495	V149A	probably damaging	Het
Slc39a12	T	A	2: 14,407,426		probably benign	Het
Sp9	G	T	2: 73,273,827	A242S	possibly damaging	Het
Srr	A	G	11: 74,911,065	V126A	possibly damaging	Het
Tatdn3	G	T	1: 191,052,849		probably benign	Het
Tex14	G	A	11: 87,499,613	V379I	probably benign	Het
Tmed6	T	C	8: 107,061,724	N197S	probably damaging	Het
Ttbk2	G	A	2: 120,748,575	L689F	probably benign	Het
Ttbk2	A	T	2: 120,745,160	I1043N	probably benign	Het
Ttn	A	G	2: 76,810,696	S5283P	probably damaging	Het
Ube3b	C	A	5: 114,402,555	S441*	probably null	Het
Ush2a	G	A	1: 188,797,830	C3272Y	probably damaging	Het
Vac14	T	A	8: 110,632,477	I95K	probably damaging	Het
Vangl2	G	A	1: 172,006,217	A433V	probably damaging	Het
Vwa5b1	A	T	4: 138,608,824	V153D	probably damaging	Het
Zfhx3	T	A	8: 108,955,650	D3240E	unknown	Het
Zfp945	A	G	17: 22,851,030	C632R	probably damaging	Het
Zfyve26	G	A	12: 79,265,802		probably benign	Het
Zyg11b	A	T	4: 108,242,076	I606N	possibly damaging	Het

Other mutations in Rptor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00537:Rptor	APN	11	119799445	missense	possibly damaging	0.92
IGL01319:Rptor	APN	11	119891170	missense	probably benign	0.01
IGL01375:Rptor	APN	11	119896436	missense	possibly damaging	0.68
IGL01899:Rptor	APN	11	119857453	missense	probably benign	0.04
IGL01927:Rptor	APN	11	119657674	missense	probably damaging	1.00
IGL02312:Rptor	APN	11	119846915	missense	possibly damaging	0.84
IGL02620:Rptor	APN	11	119780587	missense	probably benign	0.12
IGL02651:Rptor	APN	11	119892612	missense	possibly damaging	0.69
IGL03182:Rptor	APN	11	119725145	missense	probably damaging	1.00
Velocipede	UTSW	11	119895977	missense	possibly damaging	0.92
R0103:Rptor	UTSW	11	119884967	missense	probably benign	0.01
R0179:Rptor	UTSW	11	119872367	missense	probably benign	0.14
R0217:Rptor	UTSW	11	119894912	splice site	probably benign
R0219:Rptor	UTSW	11	119821777	intron	probably benign
R0324:Rptor	UTSW	11	119892641	missense	probably damaging	1.00
R0432:Rptor	UTSW	11	119780553	nonsense	probably null
R0730:Rptor	UTSW	11	119884954	missense	probably benign	0.06
R1019:Rptor	UTSW	11	119843743	missense	probably damaging	1.00
R1073:Rptor	UTSW	11	119743891	missense	possibly damaging	0.93
R1424:Rptor	UTSW	11	119780593	nonsense	probably null
R1579:Rptor	UTSW	11	119896001	missense	probably benign	0.00
R1766:Rptor	UTSW	11	119725061	missense	probably damaging	0.99
R1844:Rptor	UTSW	11	119756320	missense	probably damaging	1.00
R2180:Rptor	UTSW	11	119725144	missense	probably damaging	1.00
R2274:Rptor	UTSW	11	119756322	nonsense	probably null
R2275:Rptor	UTSW	11	119756322	nonsense	probably null
R2408:Rptor	UTSW	11	119857451	missense	probably damaging	0.99
R2981:Rptor	UTSW	11	119865594	missense	probably damaging	1.00
R2996:Rptor	UTSW	11	119856298	missense	probably damaging	1.00
R3001:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R3002:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R3003:Rptor	UTSW	11	119872371	missense	possibly damaging	0.94
R4358:Rptor	UTSW	11	119671345	missense	probably damaging	0.98
R4592:Rptor	UTSW	11	119798840	missense	probably null	1.00
R4647:Rptor	UTSW	11	119891163	missense	probably benign	0.33
R4666:Rptor	UTSW	11	119743882	missense	probably damaging	1.00
R4958:Rptor	UTSW	11	119857391	missense	probably benign	0.29
R4974:Rptor	UTSW	11	119821640	intron	probably benign
R5073:Rptor	UTSW	11	119896479	missense	possibly damaging	0.71
R5199:Rptor	UTSW	11	119603816	missense	probably benign
R5216:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5219:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5277:Rptor	UTSW	11	119822956	missense	probably damaging	1.00
R5365:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5366:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5447:Rptor	UTSW	11	119843713	missense	probably damaging	0.98
R5630:Rptor	UTSW	11	119756249	missense	probably benign	0.01
R6220:Rptor	UTSW	11	119897442	missense	possibly damaging	0.83
R6567:Rptor	UTSW	11	119896012	missense	probably benign	0.00
R6741:Rptor	UTSW	11	119895977	missense	possibly damaging	0.92
R6915:Rptor	UTSW	11	119756345	missense	probably damaging	0.99
R7032:Rptor	UTSW	11	119846936	missense	probably benign	0.00
R7051:Rptor	UTSW	11	119874186	utr 3 prime	probably benign
R7396:Rptor	UTSW	11	119872355	missense	probably benign	0.10
R7429:Rptor	UTSW	11	119846828	missense	probably damaging	1.00
R7430:Rptor	UTSW	11	119846828	missense	probably damaging	1.00
R7447:Rptor	UTSW	11	119884979	missense	probably benign	0.00
R7595:Rptor	UTSW	11	119743953	missense	possibly damaging	0.82
R7776:Rptor	UTSW	11	119892627	missense	probably benign	0.01
R7854:Rptor	UTSW	11	119857953	missense	probably benign	0.02
R8288:Rptor	UTSW	11	119857937	missense	probably benign	0.02
R8305:Rptor	UTSW	11	119811986	missense	probably damaging	1.00
R8328:Rptor	UTSW	11	119892647	missense	probably benign	0.00
R8351:Rptor	UTSW	11	119892639	missense	probably benign	0.22
R8772:Rptor	UTSW	11	119725032	missense	probably damaging	1.00
R8871:Rptor	UTSW	11	119603925	missense	probably benign	0.01
R8925:Rptor	UTSW	11	119891210	missense	probably benign	0.11
R8927:Rptor	UTSW	11	119891210	missense	probably benign	0.11
R8981:Rptor	UTSW	11	119843682	missense	possibly damaging	0.90
R9149:Rptor	UTSW	11	119887070	missense	probably benign	0.05
R9213:Rptor	UTSW	11	119603939	missense	probably benign
R9224:Rptor	UTSW	11	119894287	missense	probably benign	0.11
R9290:Rptor	UTSW	11	119811997	missense	probably benign	0.00
R9314:Rptor	UTSW	11	119895946	missense	probably benign	0.43
R9371:Rptor	UTSW	11	119671326	missense	possibly damaging	0.66
R9719:Rptor	UTSW	11	119891114	missense	probably benign	0.13
R9751:Rptor	UTSW	11	119887138	missense	probably benign	0.02
X0050:Rptor	UTSW	11	119846405	missense	probably benign	0.14
X0066:Rptor	UTSW	11	119857866	missense	probably benign	0.31
Z0001:Rptor	UTSW	11	119603972	critical splice donor site	probably null
Z0001:Rptor	UTSW	11	119756236	splice site	probably null
Z0001:Rptor	UTSW	11	119756415	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119799319	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119846752	critical splice acceptor site	probably null
Z0001:Rptor	UTSW	11	119851468	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119857453	critical splice donor site	probably benign
Z0001:Rptor	UTSW	11	119871492	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119874151	critical splice acceptor site	probably benign
Z0001:Rptor	UTSW	11	119896549	critical splice donor site	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTCAGCTTTGGCAAGTGGCAG -3'
(R):5'- TGTGGGGAGTGGAATGACCCTAAAC -3'

Sequencing Primer
(F):5'- TTCCCCGAGGTGACATTATCAAG -3'
(R):5'- AGTGGAATGACCCTAAACTAAGG -3'

Posted On

2013-07-30