Incidental Mutation 'R8233:Pdcd1'
ID637202
Institutional Source Beutler Lab
Gene Symbol Pdcd1
Ensembl Gene ENSMUSG00000026285
Gene Nameprogrammed cell death 1
SynonymsPD-1, Pdc1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location94038305-94052553 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94039417 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 252 (V252A)
Ref Sequence ENSEMBL: ENSMUSP00000027507 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027507]
PDB Structure
CRYSTAL STRUCTURE OF THE EXTRACELLULAR DOMAIN OF MURINE PD-1 [X-RAY DIFFRACTION]
Crystal Structure of the PD-1/PD-L1 Complex [X-RAY DIFFRACTION]
Crystal structure of the mouse PD-1 and PD-L2 complex [X-RAY DIFFRACTION]
Crystal structure of the mouse PD-1 Mutant and PD-L2 complex [X-RAY DIFFRACTION]
Crystal structure of the complex between mouse PD-1 mutant and PD-L2 IgV domain [X-RAY DIFFRACTION]
Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and PD-L2 [X-RAY DIFFRACTION]
Crystal structure of the complex between the extracellular domains of mouse PD-1 mutant and human PD-L1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027507
AA Change: V252A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027507
Gene: ENSMUSG00000026285
AA Change: V252A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 39 145 3.33e-9 SMART
transmembrane domain 170 192 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface membrane protein of the immunoglobulin superfamily. This protein is expressed in pro-B-cells and is thought to play a role in their differentiation. In mice, expression of this gene is induced in the thymus when anti-CD3 antibodies are injected and large numbers of thymocytes undergo apoptosis. Mice deficient for this gene bred on a BALB/c background developed dilated cardiomyopathy and died from congestive heart failure. These studies suggest that this gene product may also be important in T cell function and contribute to the prevention of autoimmune diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display abnormalities in leukopoiesis and the immune system which vary considerably depending on the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in Pdcd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Pdcd1 APN 1 94040135 splice site probably benign
IGL01522:Pdcd1 APN 1 94040846 missense probably benign 0.00
IGL02337:Pdcd1 APN 1 94040857 missense probably benign 0.08
IGL02750:Pdcd1 APN 1 94039544 splice site probably benign
R6720_Pdcd1_520 UTSW 1 94041389 missense probably benign 0.00
R0092:Pdcd1 UTSW 1 94052424 missense possibly damaging 0.49
R0554:Pdcd1 UTSW 1 94039382 missense probably damaging 1.00
R0931:Pdcd1 UTSW 1 94039513 missense probably benign 0.05
R3932:Pdcd1 UTSW 1 94041264 missense probably benign 0.01
R5222:Pdcd1 UTSW 1 94052450 missense probably damaging 0.99
R5914:Pdcd1 UTSW 1 94040825 missense probably benign 0.15
R6186:Pdcd1 UTSW 1 94040121 nonsense probably null
R6720:Pdcd1 UTSW 1 94041389 missense probably benign 0.00
R6844:Pdcd1 UTSW 1 94039381 missense probably benign 0.36
R7966:Pdcd1 UTSW 1 94041461 missense probably damaging 1.00
R8387:Pdcd1 UTSW 1 94041468 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTGTAGCCTGCATGCTCC -3'
(R):5'- TTATGGGATGCACACACCACC -3'

Sequencing Primer
(F):5'- TCTTGACTGAGGGACGGAC -3'
(R):5'- CCCCCAACTGACTATAACAATGG -3'
Posted On2020-07-13