Incidental Mutation 'R8233:Degs1'
ID637206
Institutional Source Beutler Lab
Gene Symbol Degs1
Ensembl Gene ENSMUSG00000038633
Gene Namedelta(4)-desaturase, sphingolipid 1
SynonymsMdes, Des1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location182275772-182282804 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 182279595 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 69 (V69A)
Ref Sequence ENSEMBL: ENSMUSP00000048519 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035295] [ENSMUST00000133052]
Predicted Effect probably benign
Transcript: ENSMUST00000035295
AA Change: V69A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000048519
Gene: ENSMUSG00000038633
AA Change: V69A

DomainStartEndE-ValueType
Lipid_DES 5 43 4.36e-20 SMART
Pfam:FA_desaturase 65 293 1.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133052
AA Change: V33A

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000119473
Gene: ENSMUSG00000038633
AA Change: V33A

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
transmembrane domain 37 55 N/A INTRINSIC
Pfam:FA_desaturase 59 260 4.5e-20 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane fatty acid desaturase family which is responsible for inserting double bonds into specific positions in fatty acids. This protein contains three His-containing consensus motifs that are characteristic of a group of membrane fatty acid desaturases. It is predicted to be a multiple membrane-spanning protein localized to the endoplasmic reticulum. Overexpression of this gene inhibited biosynthesis of the EGF receptor, suggesting a possible role of a fatty acid desaturase in regulating biosynthetic processing of the EGF receptor. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death, decreased to absent ceramide levels, decreased body weight, scaly skin, sparse hair, tremors, hematological and blood chemistry abnormalities, decreased bone mineral content and density and decreased liver function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in Degs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Degs1 APN 1 182279209 missense probably benign 0.34
IGL01766:Degs1 APN 1 182279095 missense probably damaging 1.00
IGL02237:Degs1 APN 1 182279688 missense probably damaging 0.97
IGL02578:Degs1 APN 1 182279027 nonsense probably null
IGL03200:Degs1 APN 1 182279691 start codon destroyed probably null 1.00
R0087:Degs1 UTSW 1 182279310 missense probably benign 0.00
R0126:Degs1 UTSW 1 182279692 start codon destroyed probably null 0.85
R0299:Degs1 UTSW 1 182279271 missense probably damaging 0.99
R4157:Degs1 UTSW 1 182282627 missense possibly damaging 0.83
R4260:Degs1 UTSW 1 182279241 missense probably benign
R4520:Degs1 UTSW 1 182276808 missense possibly damaging 0.95
R4606:Degs1 UTSW 1 182276823 missense probably damaging 0.99
R4888:Degs1 UTSW 1 182276805 missense probably damaging 0.98
R5366:Degs1 UTSW 1 182279362 missense probably benign 0.08
R6574:Degs1 UTSW 1 182279073 missense probably damaging 1.00
R7023:Degs1 UTSW 1 182279065 missense probably damaging 0.99
R7164:Degs1 UTSW 1 182279125 missense probably damaging 0.99
R7633:Degs1 UTSW 1 182279698 missense probably damaging 1.00
R7894:Degs1 UTSW 1 182276851 missense probably damaging 0.97
R7894:Degs1 UTSW 1 182276852 missense probably benign 0.00
R7905:Degs1 UTSW 1 182279036 missense possibly damaging 0.72
R8296:Degs1 UTSW 1 182282676 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- TACCGGTGGTGATCCATGTG -3'
(R):5'- AATATCTCATAAAGTCTGTCAGGGG -3'

Sequencing Primer
(F):5'- TGATCCATGTGGTATCTCTTAAAGG -3'
(R):5'- TCTGTCAGGGGGAGAATTATAAC -3'
Posted On2020-07-13