Incidental Mutation 'R8233:Gm13762'
ID637208
Institutional Source Beutler Lab
Gene Symbol Gm13762
Ensembl Gene ENSMUSG00000075111
Gene Namepredicted gene 13762
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location88972055-88980281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 88973738 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 51 (R51H)
Ref Sequence ENSEMBL: ENSMUSP00000126588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099806] [ENSMUST00000168169]
Predicted Effect
SMART Domains Protein: ENSMUSP00000097394
Gene: ENSMUSG00000101480
AA Change: R51H

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.5e-47 PFAM
Pfam:7tm_1 39 286 3.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168169
AA Change: R51H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126588
Gene: ENSMUSG00000075111
AA Change: R51H

DomainStartEndE-ValueType
Pfam:7tm_1 39 286 1.8e-26 PFAM
Pfam:7tm_4 138 282 3.3e-36 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in Gm13762
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0240:Gm13762 UTSW 2 88973396 missense probably damaging 1.00
R1446:Gm13762 UTSW 2 88973765 missense probably benign 0.00
R1845:Gm13762 UTSW 2 88973138 missense probably benign 0.22
R1868:Gm13762 UTSW 2 88973784 missense possibly damaging 0.60
R1953:Gm13762 UTSW 2 88973880 nonsense probably null
R4205:Gm13762 UTSW 2 88973138 missense probably benign 0.22
R4751:Gm13762 UTSW 2 88973133 missense probably damaging 1.00
R4895:Gm13762 UTSW 2 88973711 missense probably benign 0.39
R4937:Gm13762 UTSW 2 88973490 missense probably damaging 1.00
R5621:Gm13762 UTSW 2 88973466 missense probably benign 0.00
R5678:Gm13762 UTSW 2 88972973 nonsense probably null
R5938:Gm13762 UTSW 2 88973013 missense probably benign 0.00
R6021:Gm13762 UTSW 2 88973032 nonsense probably null
R6180:Gm13762 UTSW 2 88973882 missense probably damaging 1.00
R6724:Gm13762 UTSW 2 88973268 missense probably benign 0.02
R6873:Gm13762 UTSW 2 88973424 missense probably benign
R6893:Gm13762 UTSW 2 88973799 missense probably benign 0.00
R7221:Gm13762 UTSW 2 88973153 missense probably damaging 0.99
R7634:Gm13762 UTSW 2 88973657 missense probably damaging 1.00
R8262:Gm13762 UTSW 2 88973208 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATAGCGGTCATAGGCCATGG -3'
(R):5'- TAAGGATGTACTAGCAAGGTTAGTG -3'

Sequencing Primer
(F):5'- CGGTCATAGGCCATGGATATC -3'
(R):5'- TGTACTAGCAAGGTTAGTGGTAATAG -3'
Posted On2020-07-13