Incidental Mutation 'R8233:Tnik'
ID637211
Institutional Source Beutler Lab
Gene Symbol Tnik
Ensembl Gene ENSMUSG00000027692
Gene NameTRAF2 and NCK interacting kinase
SynonymsC630040K21Rik, 1500031A17Rik, 4831440I19Rik, C530008O15Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location28263214-28675858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28554937 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 217 (W217R)
Ref Sequence ENSEMBL: ENSMUSP00000125081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159236] [ENSMUST00000159308] [ENSMUST00000159680] [ENSMUST00000160307] [ENSMUST00000160518] [ENSMUST00000160934] [ENSMUST00000161964] [ENSMUST00000162485] [ENSMUST00000162777]
Predicted Effect probably damaging
Transcript: ENSMUST00000159236
AA Change: W217R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124681
Gene: ENSMUSG00000027692
AA Change: W217R

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 793 812 N/A INTRINSIC
low complexity region 951 958 N/A INTRINSIC
CNH 1005 1303 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159308
AA Change: W217R
SMART Domains Protein: ENSMUSP00000125466
Gene: ENSMUSG00000027692
AA Change: W217R

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 746 765 N/A INTRINSIC
low complexity region 904 911 N/A INTRINSIC
CNH 958 1256 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000159680
AA Change: W217R
SMART Domains Protein: ENSMUSP00000124876
Gene: ENSMUSG00000027692
AA Change: W217R

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 822 841 N/A INTRINSIC
low complexity region 980 987 N/A INTRINSIC
CNH 1034 1332 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160307
AA Change: W217R
SMART Domains Protein: ENSMUSP00000125081
Gene: ENSMUSG00000027692
AA Change: W217R

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 720 755 N/A INTRINSIC
low complexity region 830 849 N/A INTRINSIC
low complexity region 988 995 N/A INTRINSIC
CNH 1042 1340 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000160518
AA Change: W217R
SMART Domains Protein: ENSMUSP00000124011
Gene: ENSMUSG00000027692
AA Change: W217R

DomainStartEndE-ValueType
S_TKc 25 289 5.9e-99 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 691 726 N/A INTRINSIC
low complexity region 801 820 N/A INTRINSIC
low complexity region 959 966 N/A INTRINSIC
CNH 1013 1311 9.3e-120 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160934
SMART Domains Protein: ENSMUSP00000123859
Gene: ENSMUSG00000027692

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 25 212 2.2e-37 PFAM
Pfam:Pkinase 25 219 5.9e-52 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000161964
AA Change: W217R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125411
Gene: ENSMUSG00000027692
AA Change: W217R

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 482 N/A INTRINSIC
low complexity region 636 671 N/A INTRINSIC
low complexity region 738 757 N/A INTRINSIC
low complexity region 896 903 N/A INTRINSIC
CNH 950 1248 1.92e-117 SMART
Predicted Effect unknown
Transcript: ENSMUST00000162485
AA Change: W217R
SMART Domains Protein: ENSMUSP00000124387
Gene: ENSMUSG00000027692
AA Change: W217R

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 775 794 N/A INTRINSIC
low complexity region 933 940 N/A INTRINSIC
CNH 987 1285 1.92e-117 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162777
AA Change: W217R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124726
Gene: ENSMUSG00000027692
AA Change: W217R

DomainStartEndE-ValueType
S_TKc 25 289 1.23e-96 SMART
low complexity region 317 340 N/A INTRINSIC
coiled coil region 360 511 N/A INTRINSIC
low complexity region 665 700 N/A INTRINSIC
low complexity region 767 786 N/A INTRINSIC
low complexity region 925 932 N/A INTRINSIC
CNH 979 1277 1.92e-117 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Germinal center kinases (GCKs), such as TNIK, are characterized by an N-terminal kinase domain and a C-terminal GCK domain that serves a regulatory function (Fu et al., 1999 [PubMed 10521462]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired postsynaptic signaling and cognitive function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in Tnik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Tnik APN 3 28654218 missense probably damaging 1.00
IGL00726:Tnik APN 3 28532898 missense probably damaging 1.00
IGL01022:Tnik APN 3 28625228 splice site probably null
IGL01145:Tnik APN 3 28604167 intron probably benign
IGL01664:Tnik APN 3 28638479 missense probably damaging 1.00
IGL01843:Tnik APN 3 28570858 splice site probably null
IGL02378:Tnik APN 3 28638459 nonsense probably null
IGL02448:Tnik APN 3 28621077 missense probably null 0.01
IGL02756:Tnik APN 3 28542030 missense probably damaging 1.00
IGL03332:Tnik APN 3 28666155 missense probably damaging 1.00
delightful UTSW 3 28604185 missense probably damaging 1.00
Lovely UTSW 3 28611970 critical splice donor site probably null
Usher UTSW 3 28564097 missense possibly damaging 0.61
R0135:Tnik UTSW 3 28607245 missense possibly damaging 0.67
R0418:Tnik UTSW 3 28570880 nonsense probably null
R0540:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0549:Tnik UTSW 3 28570920 missense possibly damaging 0.87
R0556:Tnik UTSW 3 28625218 missense possibly damaging 0.95
R0586:Tnik UTSW 3 28577361 splice site probably benign
R0607:Tnik UTSW 3 28650159 missense probably damaging 1.00
R0842:Tnik UTSW 3 28594086 missense possibly damaging 0.72
R1068:Tnik UTSW 3 28532975 missense probably damaging 1.00
R1171:Tnik UTSW 3 28532940 missense probably damaging 1.00
R1597:Tnik UTSW 3 28604269 missense probably damaging 1.00
R1638:Tnik UTSW 3 28665740 missense probably damaging 0.99
R1652:Tnik UTSW 3 28604293 missense probably benign 0.22
R1996:Tnik UTSW 3 28665680 missense probably damaging 1.00
R2333:Tnik UTSW 3 28532996 missense probably damaging 1.00
R2426:Tnik UTSW 3 28646681 missense probably damaging 1.00
R2509:Tnik UTSW 3 28667915 missense probably damaging 1.00
R3774:Tnik UTSW 3 28638419 missense probably damaging 0.98
R3775:Tnik UTSW 3 28638419 missense probably damaging 0.98
R4007:Tnik UTSW 3 28604281 missense probably damaging 1.00
R4119:Tnik UTSW 3 28666175 missense probably damaging 1.00
R4209:Tnik UTSW 3 28359065 splice site probably benign
R4441:Tnik UTSW 3 28564097 missense possibly damaging 0.61
R4611:Tnik UTSW 3 28542100 critical splice donor site probably null
R4714:Tnik UTSW 3 28594077 missense possibly damaging 0.53
R4772:Tnik UTSW 3 28607210 missense probably benign 0.09
R4829:Tnik UTSW 3 28539541 intron probably benign
R4839:Tnik UTSW 3 28596075 missense possibly damaging 0.86
R4898:Tnik UTSW 3 28650086 missense probably damaging 1.00
R5029:Tnik UTSW 3 28665844 splice site probably null
R5278:Tnik UTSW 3 28650060 missense probably damaging 1.00
R5307:Tnik UTSW 3 28541972 missense probably damaging 1.00
R5330:Tnik UTSW 3 28542018 missense probably damaging 1.00
R5375:Tnik UTSW 3 28594092 missense probably benign 0.02
R5459:Tnik UTSW 3 28661741 missense probably damaging 1.00
R5708:Tnik UTSW 3 28611971 critical splice donor site probably null
R5749:Tnik UTSW 3 28594092 missense probably benign 0.02
R5751:Tnik UTSW 3 28594092 missense probably benign 0.02
R5780:Tnik UTSW 3 28594092 missense probably benign 0.02
R5837:Tnik UTSW 3 28668053 unclassified probably benign
R5969:Tnik UTSW 3 28620948 missense probably damaging 1.00
R6244:Tnik UTSW 3 28650179 missense probably damaging 1.00
R6273:Tnik UTSW 3 28577500 missense possibly damaging 0.94
R6457:Tnik UTSW 3 28539448 missense probably damaging 1.00
R6464:Tnik UTSW 3 28611970 critical splice donor site probably null
R6473:Tnik UTSW 3 28263643 start codon destroyed probably null 0.93
R6737:Tnik UTSW 3 28596086 missense possibly damaging 0.72
R7049:Tnik UTSW 3 28661704 nonsense probably null
R7237:Tnik UTSW 3 28638419 missense probably damaging 0.98
R7267:Tnik UTSW 3 28646627 missense probably damaging 0.99
R7445:Tnik UTSW 3 28663909 splice site probably null
R7499:Tnik UTSW 3 28630594 missense possibly damaging 0.47
R7629:Tnik UTSW 3 28661728 missense probably damaging 0.96
R7654:Tnik UTSW 3 28604185 missense probably damaging 1.00
R7886:Tnik UTSW 3 28666139 missense probably damaging 1.00
R8096:Tnik UTSW 3 28661778 missense possibly damaging 0.91
R8210:Tnik UTSW 3 28604333 missense possibly damaging 0.95
R8386:Tnik UTSW 3 28263674 missense unknown
R8399:Tnik UTSW 3 28494010 missense unknown
X0022:Tnik UTSW 3 28667951 missense probably damaging 1.00
Z1176:Tnik UTSW 3 28604324 missense probably damaging 1.00
Z1176:Tnik UTSW 3 28607328 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGAGAAGTGAGCGTGACTCC -3'
(R):5'- GCTCTGCAACAAACAGATTCCTG -3'

Sequencing Primer
(F):5'- AAGTGAGCGTGACTCCTCTGG -3'
(R):5'- TGCTTTCTAAATACGCCACATCAG -3'
Posted On2020-07-13