Incidental Mutation 'R8233:Mbnl1'
ID637212
Institutional Source Beutler Lab
Gene Symbol Mbnl1
Ensembl Gene ENSMUSG00000027763
Gene Namemuscleblind like splicing factor 1
Synonyms
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.935) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location60472830-60629750 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 60625130 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 274 (I274L)
Ref Sequence ENSEMBL: ENSMUSP00000141915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099087] [ENSMUST00000191747] [ENSMUST00000192607] [ENSMUST00000192807] [ENSMUST00000193517] [ENSMUST00000193518] [ENSMUST00000193647] [ENSMUST00000194069] [ENSMUST00000194201] [ENSMUST00000195817]
Predicted Effect probably benign
Transcript: ENSMUST00000099087
AA Change: I366L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000096686
Gene: ENSMUSG00000027763
AA Change: I366L

DomainStartEndE-ValueType
ZnF_C3H1 14 40 2.57e-3 SMART
ZnF_C3H1 47 72 1.43e-1 SMART
low complexity region 89 107 N/A INTRINSIC
ZnF_C3H1 178 205 1.77e-6 SMART
ZnF_C3H1 215 239 2.91e-2 SMART
low complexity region 248 273 N/A INTRINSIC
low complexity region 338 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191747
AA Change: I239L

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142057
Gene: ENSMUSG00000027763
AA Change: I239L

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
ZnF_C3H1 86 113 1.77e-6 SMART
ZnF_C3H1 123 147 2.91e-2 SMART
low complexity region 156 185 N/A INTRINSIC
low complexity region 211 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192607
AA Change: H334L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000142095
Gene: ENSMUSG00000027763
AA Change: H334L

DomainStartEndE-ValueType
ZnF_C3H1 14 40 2.57e-3 SMART
ZnF_C3H1 47 72 1.43e-1 SMART
low complexity region 89 107 N/A INTRINSIC
ZnF_C3H1 178 205 1.77e-6 SMART
ZnF_C3H1 215 239 2.91e-2 SMART
low complexity region 248 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192807
AA Change: I274L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000141915
Gene: ENSMUSG00000027763
AA Change: I274L

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
ZnF_C3H1 86 113 7.5e-9 SMART
ZnF_C3H1 123 147 1.3e-4 SMART
low complexity region 156 181 N/A INTRINSIC
low complexity region 246 269 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193517
AA Change: I372L

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000141287
Gene: ENSMUSG00000027763
AA Change: I372L

DomainStartEndE-ValueType
ZnF_C3H1 14 40 1.1e-5 SMART
ZnF_C3H1 47 72 6.1e-4 SMART
low complexity region 89 107 N/A INTRINSIC
ZnF_C3H1 178 205 7.5e-9 SMART
ZnF_C3H1 215 239 1.3e-4 SMART
low complexity region 248 272 N/A INTRINSIC
low complexity region 344 367 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193518
AA Change: I287L

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000142088
Gene: ENSMUSG00000027763
AA Change: I287L

DomainStartEndE-ValueType
ZnF_C3H1 81 108 7.5e-9 SMART
ZnF_C3H1 118 142 1.3e-4 SMART
low complexity region 151 175 N/A INTRINSIC
low complexity region 259 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193647
SMART Domains Protein: ENSMUSP00000141536
Gene: ENSMUSG00000027763

DomainStartEndE-ValueType
low complexity region 1 15 N/A INTRINSIC
ZnF_C3H1 86 113 7.5e-9 SMART
ZnF_C3H1 123 147 1.3e-4 SMART
low complexity region 156 180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194069
AA Change: H340L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000141474
Gene: ENSMUSG00000027763
AA Change: H340L

DomainStartEndE-ValueType
ZnF_C3H1 14 40 1.1e-5 SMART
ZnF_C3H1 47 72 6.1e-4 SMART
low complexity region 89 107 N/A INTRINSIC
ZnF_C3H1 178 205 7.5e-9 SMART
ZnF_C3H1 215 239 1.3e-4 SMART
low complexity region 248 272 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194201
AA Change: I287L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000141954
Gene: ENSMUSG00000027763
AA Change: I287L

DomainStartEndE-ValueType
ZnF_C3H1 14 40 2.57e-3 SMART
ZnF_C3H1 47 72 1.43e-1 SMART
low complexity region 89 107 N/A INTRINSIC
ZnF_C3H1 111 138 1.23e-5 SMART
ZnF_C3H1 148 172 2.91e-2 SMART
low complexity region 181 206 N/A INTRINSIC
low complexity region 259 282 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195817
AA Change: H202L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000141576
Gene: ENSMUSG00000027763
AA Change: H202L

DomainStartEndE-ValueType
ZnF_C3H1 81 108 7.5e-9 SMART
ZnF_C3H1 118 142 1.3e-4 SMART
low complexity region 151 180 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the muscleblind protein family which was initially described in Drosophila melanogaster. The encoded protein is a C3H-type zinc finger protein that modulates alternative splicing of pre-mRNAs. Muscleblind proteins bind specifically to expanded dsCUG RNA but not to normal size CUG repeats and may thereby play a role in the pathophysiology of myotonic dystrophy. Mice lacking this gene exhibited muscle abnormalities and cataracts. Several alternatively spliced transcript variants have been described but the full-length natures of only some have been determined. The different isoforms are thought to have different binding specificities and/or splicing activities. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a targeted mutation that disrupts exon 3 exhibit myotonia, cataracts and RNA splicing defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in Mbnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01936:Mbnl1 APN 3 60613519 missense possibly damaging 0.45
IGL02382:Mbnl1 APN 3 60625142 nonsense probably null
IGL02970:Mbnl1 APN 3 60613423 missense probably damaging 1.00
R1662:Mbnl1 UTSW 3 60625172 missense probably damaging 1.00
R4062:Mbnl1 UTSW 3 60603755 missense probably damaging 1.00
R4577:Mbnl1 UTSW 3 60529778 missense probably damaging 1.00
R4960:Mbnl1 UTSW 3 60595696 start codon destroyed probably null
R6184:Mbnl1 UTSW 3 60615744 missense probably damaging 0.99
R6229:Mbnl1 UTSW 3 60621328 splice site probably null
R7219:Mbnl1 UTSW 3 60603823 missense probably benign 0.32
R7397:Mbnl1 UTSW 3 60615630 missense probably benign 0.04
R7808:Mbnl1 UTSW 3 60614821 splice site probably null
R8435:Mbnl1 UTSW 3 60529669 nonsense probably null
R8459:Mbnl1 UTSW 3 60622207 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATGGAGATTACAAGCAGTGATTTGC -3'
(R):5'- CCTGCTCTGTGGCTTTAAGG -3'

Sequencing Primer
(F):5'- CAGTGATTTGCTTCTATGGCATTTAC -3'
(R):5'- CTGCTCTGTGGCTTTAAGGTATCTTC -3'
Posted On2020-07-13