Incidental Mutation 'R8233:D5Ertd579e'
ID637220
Institutional Source Beutler Lab
Gene Symbol D5Ertd579e
Ensembl Gene ENSMUSG00000029190
Gene NameDNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location36600485-36696024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 36615244 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 602 (D602E)
Ref Sequence ENSEMBL: ENSMUSP00000031091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031091]
Predicted Effect probably damaging
Transcript: ENSMUST00000031091
AA Change: D602E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000031091
Gene: ENSMUSG00000029190
AA Change: D602E

DomainStartEndE-ValueType
Pfam:DUF4603 23 1303 N/A PFAM
low complexity region 1365 1376 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132383
SMART Domains Protein: ENSMUSP00000116548
Gene: ENSMUSG00000029190

DomainStartEndE-ValueType
Pfam:DUF4603 1 1181 N/A PFAM
low complexity region 1243 1254 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in D5Ertd579e
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:D5Ertd579e APN 5 36618754 missense probably damaging 0.99
IGL01925:D5Ertd579e APN 5 36614284 missense possibly damaging 0.67
IGL01933:D5Ertd579e APN 5 36615756 missense probably benign
IGL02164:D5Ertd579e APN 5 36614959 missense probably damaging 1.00
IGL02399:D5Ertd579e APN 5 36616185 missense probably damaging 1.00
IGL02896:D5Ertd579e APN 5 36613982 missense possibly damaging 0.70
IGL03141:D5Ertd579e APN 5 36613277 missense possibly damaging 0.94
IGL03235:D5Ertd579e APN 5 36618828 splice site probably benign
R0201:D5Ertd579e UTSW 5 36616465 missense probably damaging 1.00
R0377:D5Ertd579e UTSW 5 36604567 missense probably benign 0.12
R0830:D5Ertd579e UTSW 5 36613757 missense probably damaging 1.00
R0926:D5Ertd579e UTSW 5 36672866 missense probably damaging 1.00
R1350:D5Ertd579e UTSW 5 36613737 missense probably damaging 1.00
R1448:D5Ertd579e UTSW 5 36602739 missense probably benign
R1672:D5Ertd579e UTSW 5 36613277 missense possibly damaging 0.50
R1676:D5Ertd579e UTSW 5 36616109 missense probably benign 0.01
R1693:D5Ertd579e UTSW 5 36614097 missense probably damaging 0.98
R1698:D5Ertd579e UTSW 5 36604530 missense probably benign
R1868:D5Ertd579e UTSW 5 36616427 missense probably damaging 0.99
R1909:D5Ertd579e UTSW 5 36614058 missense probably benign 0.21
R2034:D5Ertd579e UTSW 5 36613538 nonsense probably null
R2080:D5Ertd579e UTSW 5 36616206 missense probably benign 0.01
R2105:D5Ertd579e UTSW 5 36613449 missense probably benign 0.12
R2197:D5Ertd579e UTSW 5 36614793 missense possibly damaging 0.69
R4212:D5Ertd579e UTSW 5 36614479 missense probably damaging 0.99
R4452:D5Ertd579e UTSW 5 36616470 missense probably damaging 1.00
R4626:D5Ertd579e UTSW 5 36614559 missense possibly damaging 0.92
R4804:D5Ertd579e UTSW 5 36629652 splice site probably null
R4898:D5Ertd579e UTSW 5 36614941 missense probably damaging 0.99
R4917:D5Ertd579e UTSW 5 36615816 missense probably damaging 1.00
R4960:D5Ertd579e UTSW 5 36616227 nonsense probably null
R4973:D5Ertd579e UTSW 5 36672905 missense probably benign
R5092:D5Ertd579e UTSW 5 36602703 missense probably benign 0.18
R5474:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5475:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5476:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5477:D5Ertd579e UTSW 5 36615257 missense probably damaging 1.00
R5801:D5Ertd579e UTSW 5 36604569 missense probably damaging 1.00
R6019:D5Ertd579e UTSW 5 36629692 missense possibly damaging 0.90
R6184:D5Ertd579e UTSW 5 36629783 missense probably damaging 0.99
R6213:D5Ertd579e UTSW 5 36602634 missense probably damaging 1.00
R6244:D5Ertd579e UTSW 5 36615276 missense probably damaging 0.98
R6276:D5Ertd579e UTSW 5 36604514 missense possibly damaging 0.66
R6285:D5Ertd579e UTSW 5 36615577 missense probably damaging 1.00
R6358:D5Ertd579e UTSW 5 36616236 splice site probably null
R6875:D5Ertd579e UTSW 5 36604657 splice site probably null
R6967:D5Ertd579e UTSW 5 36615756 missense probably benign
R7139:D5Ertd579e UTSW 5 36613976 missense probably damaging 1.00
R7329:D5Ertd579e UTSW 5 36616395 missense probably benign 0.21
R7464:D5Ertd579e UTSW 5 36613785 missense probably damaging 0.99
R7664:D5Ertd579e UTSW 5 36614617 missense probably benign 0.00
R7762:D5Ertd579e UTSW 5 36613381 missense
R7951:D5Ertd579e UTSW 5 36615173 missense probably benign
R8175:D5Ertd579e UTSW 5 36615470 missense probably damaging 1.00
R8217:D5Ertd579e UTSW 5 36614058 missense probably benign 0.00
R8281:D5Ertd579e UTSW 5 36613320 missense
R8398:D5Ertd579e UTSW 5 36614277 nonsense probably null
RF022:D5Ertd579e UTSW 5 36614662 missense probably damaging 1.00
X0019:D5Ertd579e UTSW 5 36613958 missense probably damaging 1.00
Z1176:D5Ertd579e UTSW 5 36615762 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGTTCACTTCCCAAGTTGAGTG -3'
(R):5'- TGCCTCAGAAACAATGCAAGG -3'

Sequencing Primer
(F):5'- CTTCCCAAGTTGAGTGTTTCAAAAG -3'
(R):5'- AGTCGGATTTTGAATATGATTCGAC -3'
Posted On2020-07-13