Incidental Mutation 'R8233:Olfr60'
ID637225
Institutional Source Beutler Lab
Gene Symbol Olfr60
Ensembl Gene ENSMUSG00000060112
Gene Nameolfactory receptor 60
SynonymsIH6, GA_x6K02T2PBJ9-42496183-42495251, MOR253-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location140343815-140361671 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 140345498 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 164 (M164L)
Ref Sequence ENSEMBL: ENSMUSP00000074916 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075470] [ENSMUST00000210932] [ENSMUST00000211031]
Predicted Effect probably benign
Transcript: ENSMUST00000075470
AA Change: M164L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000074916
Gene: ENSMUSG00000060112
AA Change: M164L

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.2e-50 PFAM
Pfam:7TM_GPCR_Srsx 36 161 1.8e-8 PFAM
Pfam:7tm_1 42 291 2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210932
Predicted Effect probably benign
Transcript: ENSMUST00000211031
AA Change: M164L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in Olfr60
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00225:Olfr60 APN 7 140345210 missense probably damaging 1.00
IGL03493:Olfr60 APN 7 140345153 missense probably damaging 1.00
R0413:Olfr60 UTSW 7 140345195 missense possibly damaging 0.94
R0652:Olfr60 UTSW 7 140345632 missense probably damaging 1.00
R1848:Olfr60 UTSW 7 140345987 start codon destroyed probably benign
R1908:Olfr60 UTSW 7 140345465 missense probably benign 0.05
R1909:Olfr60 UTSW 7 140345465 missense probably benign 0.05
R5133:Olfr60 UTSW 7 140345323 missense probably damaging 1.00
R5320:Olfr60 UTSW 7 140345635 missense probably benign 0.00
R5429:Olfr60 UTSW 7 140345273 missense possibly damaging 0.67
R6595:Olfr60 UTSW 7 140345647 missense probably damaging 1.00
R6621:Olfr60 UTSW 7 140345455 missense probably damaging 1.00
R7300:Olfr60 UTSW 7 140345355 missense probably damaging 1.00
R7409:Olfr60 UTSW 7 140345405 missense probably benign 0.00
R7562:Olfr60 UTSW 7 140345230 missense probably damaging 1.00
R7646:Olfr60 UTSW 7 140345951 missense probably damaging 1.00
R8158:Olfr60 UTSW 7 140345249 missense probably benign 0.03
R8238:Olfr60 UTSW 7 140345890 missense probably damaging 1.00
R8338:Olfr60 UTSW 7 140345393 missense probably benign 0.00
Z1088:Olfr60 UTSW 7 140345804 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- AAAAGGCCTTCCTCTTGCCC -3'
(R):5'- GTGGTCCTTGTCTTCAGAGC -3'

Sequencing Primer
(F):5'- TCAGCAGAACGCATGCG -3'
(R):5'- TGTCTTCAGAGCTGCTGC -3'
Posted On2020-07-13