Mutagenetix > Incidental Mutations

Incidental Mutation 'R0718:Zfyve26'

63723

Institutional Source

Beutler Lab

Gene Symbol

Zfyve26

Ensembl Gene

ENSMUSG00000066440

Gene Name

zinc finger, FYVE domain containing 26

Synonyms

A630028O16Rik, LOC380767, 9330197E15Rik

MMRRC Submission

038900-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0718 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

79232346-79296304 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 79265802 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000151290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021547] [ENSMUST00000218377] [ENSMUST00000219912]

Predicted Effect

probably benign
Transcript: ENSMUST00000021547

SMART Domains

Protein: ENSMUSP00000021547
Gene: ENSMUSG00000066440

Domain	Start	End	E-Value	Type
low complexity region	8	24	N/A	INTRINSIC
low complexity region	233	244	N/A	INTRINSIC
low complexity region	752	775	N/A	INTRINSIC
low complexity region	778	796	N/A	INTRINSIC
low complexity region	982	1001	N/A	INTRINSIC
low complexity region	1073	1091	N/A	INTRINSIC
low complexity region	1104	1115	N/A	INTRINSIC
low complexity region	1151	1163	N/A	INTRINSIC
low complexity region	1177	1192	N/A	INTRINSIC
low complexity region	1228	1241	N/A	INTRINSIC
low complexity region	1565	1584	N/A	INTRINSIC
low complexity region	1743	1770	N/A	INTRINSIC
FYVE	1794	1863	1.49e-27	SMART
low complexity region	2486	2498	N/A	INTRINSIC
low complexity region	2517	2528	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000218377

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219842

Predicted Effect

probably benign
Transcript: ENSMUST00000219912

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220092

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000220262

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a FYVE zinc finger binding domain. The presence of this domain is thought to target these proteins to membrane lipids through interaction with phospholipids in the membrane. Mutations in this gene are associated with autosomal recessive spastic paraplegia-15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygoys for a null allele display a late-onset spastic gait disorder with cerebellar ataxia, axon degeneration, and progressive loss of cortical motoneurons and Purkinje cells preceded by accumulation of autofluorescent, electron-dense, membrane-enclosed material in lysosomal structures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl4	A	T	3: 95,679,608	Y811N	possibly damaging	Het
Adrm1	T	C	2: 180,175,147		probably benign	Het
Alms1	T	A	6: 85,621,821	S1210T	probably benign	Het
Ampd3	C	T	7: 110,777,808	P11L	probably damaging	Het
Arhgap5	A	G	12: 52,516,507	E87G	possibly damaging	Het
Armc5	C	T	7: 128,240,070		probably benign	Het
Asic2	C	G	11: 80,971,456		probably benign	Het
Asph	A	G	4: 9,514,683		probably benign	Het
Bicd2	T	A	13: 49,377,875		probably null	Het
Brip1	A	G	11: 86,143,305	L530P	possibly damaging	Het
Bsn	G	T	9: 108,111,360		probably benign	Het
Btnl4	T	A	17: 34,469,634	H390L	probably benign	Het
Ccdc70	A	C	8: 21,973,308	K38T	probably damaging	Het
Ccni	G	A	5: 93,202,316	P35S	probably benign	Het
Cdh17	A	G	4: 11,810,451	D714G	possibly damaging	Het
Cenpf	A	G	1: 189,653,984	L2033P	probably damaging	Het
Cfap69	A	T	5: 5,621,924	M328K	probably damaging	Het
Cmah	T	G	13: 24,417,210		probably null	Het
Cog6	T	C	3: 53,010,629	T163A	probably benign	Het
Cyp2j8	G	A	4: 96,501,196	S130F	probably benign	Het
Dgki	A	G	6: 37,012,896	V636A	probably damaging	Het
Dmkn	T	A	7: 30,764,786		probably benign	Het
Dnah6	A	G	6: 73,035,293	I3679T	possibly damaging	Het
Dsp	A	T	13: 38,196,764	Y2495F	possibly damaging	Het
Exosc4	C	T	15: 76,329,489	A171V	probably benign	Het
Fbxw24	A	G	9: 109,623,509		probably benign	Het
Flvcr1	A	T	1: 191,025,582	L171Q	probably damaging	Het
Fsd1	G	T	17: 55,996,445		probably null	Het
Gm7732	A	G	17: 21,129,844		noncoding transcript	Het
H2-K2	A	C	17: 33,975,623		noncoding transcript	Het
Hgf	A	G	5: 16,593,859	N295S	probably damaging	Het
Ift88	T	A	14: 57,517,413	D811E	probably benign	Het
Igsf9b	T	A	9: 27,323,361		probably null	Het
Immt	T	A	6: 71,863,172	V311E	probably damaging	Het
Ipo11	T	A	13: 106,919,611	N51I	possibly damaging	Het
Isy1	T	C	6: 87,819,176	K260E	probably damaging	Het
Jchain	T	G	5: 88,526,202	I28L	probably benign	Het
Jmjd1c	T	A	10: 67,218,946		probably null	Het
Kif13b	T	C	14: 64,751,662		probably benign	Het
Klhdc7b	T	C	15: 89,388,169	Y427H	possibly damaging	Het
Klhl8	T	C	5: 103,876,293		probably benign	Het
Lrp2	C	T	2: 69,510,948	D963N	probably damaging	Het
Ltbp3	G	T	19: 5,746,748		probably benign	Het
Ltf	C	A	9: 111,040,379	Q41K	probably benign	Het
Med4	T	A	14: 73,516,657	I148N	probably damaging	Het
Mlh3	T	G	12: 85,247,697	S1242R	possibly damaging	Het
Mllt6	T	C	11: 97,676,359		probably benign	Het
Mpdz	A	G	4: 81,292,473	I1712T	possibly damaging	Het
Mrgprb4	T	A	7: 48,198,553	H209L	probably benign	Het
Nkapl	A	T	13: 21,468,440	M1K	probably null	Het
Nmur2	T	A	11: 56,029,498		probably benign	Het
Nsun2	T	A	13: 69,543,697		probably benign	Het
Olfr1082	G	A	2: 86,594,081	T249I	probably benign	Het
Olfr1130	A	G	2: 87,607,927	I180V	probably benign	Het
Ovgp1	T	C	3: 105,974,830		probably benign	Het
Pcdh8	A	G	14: 79,770,691	V144A	possibly damaging	Het
Pcnx3	G	A	19: 5,677,728		probably benign	Het
Pla2r1	C	A	2: 60,479,530	V570L	possibly damaging	Het
Plxnd1	C	A	6: 115,966,638	E1202D	possibly damaging	Het
Ppp1r37	T	C	7: 19,532,254	E529G	probably benign	Het
Prdm15	A	G	16: 97,812,633	F496L	possibly damaging	Het
Prlhr	A	T	19: 60,468,005	V41D	probably benign	Het
Prlhr	G	T	19: 60,468,059	S23*	probably null	Het
Prpf4	C	T	4: 62,414,540		probably benign	Het
Psg26	C	T	7: 18,475,235	R416H	probably benign	Het
Psg26	T	C	7: 18,478,287	H381R	probably benign	Het
Ralgds	T	G	2: 28,549,116	M717R	probably benign	Het
Rbms1	T	C	2: 60,842,412	N44D	probably damaging	Het
Rpa1	T	C	11: 75,318,401		probably benign	Het
Rprd2	T	C	3: 95,766,387	N568S	probably benign	Het
Rptor	A	G	11: 119,872,376	M929V	probably benign	Het
Rspo1	T	A	4: 125,007,149	C97S	possibly damaging	Het
Scin	C	T	12: 40,079,607	G396S	probably damaging	Het
Scn9a	T	C	2: 66,547,112	N409D	probably damaging	Het
Sf3b1	A	G	1: 55,019,385	I15T	probably damaging	Het
Sh3bp2	T	C	5: 34,555,495	V149A	probably damaging	Het
Slc39a12	T	A	2: 14,407,426		probably benign	Het
Sp9	G	T	2: 73,273,827	A242S	possibly damaging	Het
Srr	A	G	11: 74,911,065	V126A	possibly damaging	Het
Tatdn3	G	T	1: 191,052,849		probably benign	Het
Tex14	G	A	11: 87,499,613	V379I	probably benign	Het
Tmed6	T	C	8: 107,061,724	N197S	probably damaging	Het
Ttbk2	G	A	2: 120,748,575	L689F	probably benign	Het
Ttbk2	A	T	2: 120,745,160	I1043N	probably benign	Het
Ttn	A	G	2: 76,810,696	S5283P	probably damaging	Het
Ube3b	C	A	5: 114,402,555	S441*	probably null	Het
Ush2a	G	A	1: 188,797,830	C3272Y	probably damaging	Het
Vac14	T	A	8: 110,632,477	I95K	probably damaging	Het
Vangl2	G	A	1: 172,006,217	A433V	probably damaging	Het
Vwa5b1	A	T	4: 138,608,824	V153D	probably damaging	Het
Zfhx3	T	A	8: 108,955,650	D3240E	unknown	Het
Zfp945	A	G	17: 22,851,030	C632R	probably damaging	Het
Zyg11b	A	T	4: 108,242,076	I606N	possibly damaging	Het

Other mutations in Zfyve26

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Zfyve26	APN	12	79249460	unclassified	probably benign
IGL00940:Zfyve26	APN	12	79280900	missense	probably benign
IGL01148:Zfyve26	APN	12	79260870	missense	probably benign	0.01
IGL01347:Zfyve26	APN	12	79252183	splice site	probably null
IGL01472:Zfyve26	APN	12	79276343	missense	probably benign	0.01
IGL01490:Zfyve26	APN	12	79244373	missense	probably damaging	1.00
IGL01516:Zfyve26	APN	12	79287851	missense	probably benign	0.37
IGL01642:Zfyve26	APN	12	79261574	splice site	probably null
IGL01689:Zfyve26	APN	12	79284053	missense	possibly damaging	0.71
IGL01877:Zfyve26	APN	12	79287444	missense	probably damaging	1.00
IGL01997:Zfyve26	APN	12	79244400	missense	probably benign	0.00
IGL02077:Zfyve26	APN	12	79276395	missense	possibly damaging	0.54
IGL02437:Zfyve26	APN	12	79268847	missense	probably benign	0.01
IGL02933:Zfyve26	APN	12	79280080	missense	possibly damaging	0.94
IGL02937:Zfyve26	APN	12	79239020	missense	probably benign	0.08
IGL02982:Zfyve26	APN	12	79263870	missense	probably damaging	0.99
IGL03064:Zfyve26	APN	12	79261791	missense	probably damaging	1.00
IGL03086:Zfyve26	APN	12	79295564	missense	probably damaging	0.96
IGL03146:Zfyve26	APN	12	79284072	nonsense	probably null
IGL02799:Zfyve26	UTSW	12	79273310	missense	probably benign	0.28
R0318:Zfyve26	UTSW	12	79276281	missense	probably damaging	1.00
R0513:Zfyve26	UTSW	12	79244484	missense	probably damaging	1.00
R0582:Zfyve26	UTSW	12	79246222	missense	probably damaging	1.00
R0586:Zfyve26	UTSW	12	79268728	missense	possibly damaging	0.96
R0738:Zfyve26	UTSW	12	79295534	missense	probably damaging	1.00
R0781:Zfyve26	UTSW	12	79280067	missense	probably damaging	0.99
R0894:Zfyve26	UTSW	12	79273598	missense	possibly damaging	0.80
R1109:Zfyve26	UTSW	12	79272127	missense	probably damaging	1.00
R1110:Zfyve26	UTSW	12	79280067	missense	probably damaging	0.99
R1186:Zfyve26	UTSW	12	79263949	missense	probably damaging	1.00
R1295:Zfyve26	UTSW	12	79274920	missense	probably damaging	1.00
R1430:Zfyve26	UTSW	12	79282817	missense	probably benign	0.07
R1439:Zfyve26	UTSW	12	79252163	missense	probably benign	0.03
R1517:Zfyve26	UTSW	12	79252151	missense	probably damaging	0.98
R1553:Zfyve26	UTSW	12	79287761	missense	probably benign	0.00
R1721:Zfyve26	UTSW	12	79261799	missense	possibly damaging	0.94
R1758:Zfyve26	UTSW	12	79238944	missense	probably damaging	1.00
R1779:Zfyve26	UTSW	12	79278463	missense	probably damaging	1.00
R1785:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R1786:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R1826:Zfyve26	UTSW	12	79269049	missense	probably damaging	1.00
R1833:Zfyve26	UTSW	12	79286258	missense	probably benign	0.36
R1868:Zfyve26	UTSW	12	79261799	missense	possibly damaging	0.94
R1900:Zfyve26	UTSW	12	79264351	missense	probably damaging	1.00
R1928:Zfyve26	UTSW	12	79239970	nonsense	probably null
R1982:Zfyve26	UTSW	12	79255243	missense	possibly damaging	0.55
R2062:Zfyve26	UTSW	12	79284032	splice site	probably null
R2071:Zfyve26	UTSW	12	79287446	missense	possibly damaging	0.95
R2130:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2132:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2133:Zfyve26	UTSW	12	79268434	missense	possibly damaging	0.48
R2135:Zfyve26	UTSW	12	79246052	missense	possibly damaging	0.80
R2207:Zfyve26	UTSW	12	79246087	missense	probably damaging	0.99
R2280:Zfyve26	UTSW	12	79275040	missense	probably damaging	1.00
R2352:Zfyve26	UTSW	12	79284116	missense	probably damaging	1.00
R2398:Zfyve26	UTSW	12	79282799	splice site	probably null
R3084:Zfyve26	UTSW	12	79265683	splice site	probably benign
R3086:Zfyve26	UTSW	12	79265683	splice site	probably benign
R4626:Zfyve26	UTSW	12	79269070	missense	possibly damaging	0.95
R4727:Zfyve26	UTSW	12	79244396	missense	probably benign	0.16
R4908:Zfyve26	UTSW	12	79249695	splice site	probably null
R4926:Zfyve26	UTSW	12	79275011	missense	probably benign
R4990:Zfyve26	UTSW	12	79287833	missense	probably damaging	1.00
R4999:Zfyve26	UTSW	12	79280385	nonsense	probably null
R5029:Zfyve26	UTSW	12	79286323	missense	probably damaging	0.99
R5070:Zfyve26	UTSW	12	79255361	missense	probably damaging	1.00
R5100:Zfyve26	UTSW	12	79280058	nonsense	probably null
R5252:Zfyve26	UTSW	12	79268982	missense	probably damaging	1.00
R5318:Zfyve26	UTSW	12	79270850	missense	probably benign	0.35
R5509:Zfyve26	UTSW	12	79246521	missense	probably damaging	1.00
R5574:Zfyve26	UTSW	12	79239924	missense	possibly damaging	0.63
R5735:Zfyve26	UTSW	12	79273373	missense	probably damaging	0.96
R5756:Zfyve26	UTSW	12	79264357	missense	probably damaging	1.00
R5773:Zfyve26	UTSW	12	79287737	missense	probably damaging	1.00
R5834:Zfyve26	UTSW	12	79266537	missense	probably benign	0.30
R6075:Zfyve26	UTSW	12	79293854	missense	possibly damaging	0.74
R6184:Zfyve26	UTSW	12	79268727	missense	probably damaging	0.98
R6235:Zfyve26	UTSW	12	79249599	missense	probably damaging	1.00
R6247:Zfyve26	UTSW	12	79282984	missense	probably benign	0.04
R6320:Zfyve26	UTSW	12	79240002	missense	probably damaging	0.97
R6548:Zfyve26	UTSW	12	79238335	missense	probably damaging	1.00
R6887:Zfyve26	UTSW	12	79266449	missense	probably damaging	1.00
R7133:Zfyve26	UTSW	12	79284152	missense	probably benign	0.06
R7152:Zfyve26	UTSW	12	79279114	missense	probably benign	0.42
R7165:Zfyve26	UTSW	12	79280405	missense	probably damaging	1.00
R7181:Zfyve26	UTSW	12	79268408	missense	probably benign	0.00
R7223:Zfyve26	UTSW	12	79246171	missense	probably damaging	0.99
R7296:Zfyve26	UTSW	12	79278372	splice site	probably null
R7299:Zfyve26	UTSW	12	79282984	missense	probably benign	0.01
R7301:Zfyve26	UTSW	12	79282984	missense	probably benign	0.01
R7302:Zfyve26	UTSW	12	79251168	missense	probably damaging	1.00
R7355:Zfyve26	UTSW	12	79240054	missense	probably damaging	1.00
R7466:Zfyve26	UTSW	12	79287807	missense	probably benign	0.00
R7540:Zfyve26	UTSW	12	79268676	missense	probably damaging	0.99
R7552:Zfyve26	UTSW	12	79290957	missense	probably damaging	0.97
R7762:Zfyve26	UTSW	12	79268635	missense	probably benign	0.02
R7806:Zfyve26	UTSW	12	79280355	critical splice donor site	probably null
R7821:Zfyve26	UTSW	12	79255324	missense	probably damaging	1.00
R8141:Zfyve26	UTSW	12	79268557	missense	possibly damaging	0.79
R8190:Zfyve26	UTSW	12	79280836	missense	probably benign	0.00
R8207:Zfyve26	UTSW	12	79260831	missense	probably damaging	1.00
R8210:Zfyve26	UTSW	12	79255263	missense	probably damaging	1.00
R8500:Zfyve26	UTSW	12	79287680	missense	probably damaging	0.99
RF010:Zfyve26	UTSW	12	79255338	missense	probably damaging	1.00
X0020:Zfyve26	UTSW	12	79239005	missense	probably damaging	1.00
Z1176:Zfyve26	UTSW	12	79268533	missense	probably benign	0.07
Z1177:Zfyve26	UTSW	12	79287375	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- CAGCAATTCCGTGTGCAGTACATTC -3'
(R):5'- CTCAGCAGTGAGAACATCCTGTCC -3'

Sequencing Primer
(F):5'- TATGTGGACACTGATACACGC -3'
(R):5'- GTGAGAACATCCTGTCCTGACTG -3'

Posted On

2013-07-30