Incidental Mutation 'R8233:Igfbp3'
ID637230
Institutional Source Beutler Lab
Gene Symbol Igfbp3
Ensembl Gene ENSMUSG00000020427
Gene Nameinsulin-like growth factor binding protein 3
SynonymsIGFBP-3
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location7206086-7213923 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7210152 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 167 (H167L)
Ref Sequence ENSEMBL: ENSMUSP00000020702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020702] [ENSMUST00000135887]
Predicted Effect probably benign
Transcript: ENSMUST00000020702
AA Change: H167L

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020702
Gene: ENSMUSG00000020427
AA Change: H167L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IB 38 118 1.05e-31 SMART
TY 238 290 2.22e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135887
AA Change: H167L

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000131670
Gene: ENSMUSG00000020427
AA Change: H167L

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IB 38 118 1.05e-31 SMART
TY 238 290 2.22e-20 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP domain and a thyroglobulin type-I domain. The protein forms a ternary complex with insulin-like growth factor acid-labile subunit (IGFALS) and either insulin-like growth factor (IGF) I or II. In this form, it circulates in the plasma, prolonging the half-life of IGFs and altering their interaction with cell surface receptors. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele exhibit normal body weight. Mice homozygous for another knock-out allele exhibit increased body weight, and show altered hepatic carbohydrate and lipid metabolism when fed a high-fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in Igfbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01338:Igfbp3 APN 11 7208478 missense possibly damaging 0.69
IGL01990:Igfbp3 APN 11 7208504 missense probably damaging 1.00
R1756:Igfbp3 UTSW 11 7208461 missense probably damaging 1.00
R5936:Igfbp3 UTSW 11 7209472 missense probably damaging 1.00
R8098:Igfbp3 UTSW 11 7210104 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GGACTGCCTACCTATGAACC -3'
(R):5'- ATTGCCTTGTAGGTGTGACC -3'

Sequencing Primer
(F):5'- ACTTGCTGCACAAAGGCTGTC -3'
(R):5'- GACCTGCCCCTGACAAGGTTATC -3'
Posted On2020-07-13