Incidental Mutation 'R8233:Slfn4'
ID637231
Institutional Source Beutler Lab
Gene Symbol Slfn4
Ensembl Gene ENSMUSG00000000204
Gene Nameschlafen 4
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location83175186-83190216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 83187529 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 381 (E381G)
Ref Sequence ENSEMBL: ENSMUSP00000000208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000208] [ENSMUST00000019130] [ENSMUST00000167596]
Predicted Effect probably damaging
Transcript: ENSMUST00000000208
AA Change: E381G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000208
Gene: ENSMUSG00000000204
AA Change: E381G

DomainStartEndE-ValueType
Pfam:AlbA_2 243 382 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000019130
SMART Domains Protein: ENSMUSP00000019130
Gene: ENSMUSG00000018986

DomainStartEndE-ValueType
Pfam:AlbA_2 165 303 5.5e-11 PFAM
low complexity region 394 412 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167596
AA Change: E381G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132595
Gene: ENSMUSG00000000204
AA Change: E381G

DomainStartEndE-ValueType
Pfam:AAA_4 243 385 1e-14 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the Schlafen family. All members of this family contain a Schlafen box domain that lies near an AAA domain. This protein belongs to the group 2 subset of Schlafen proteins, which are defined by a molecular weight between 58 kDa and 68 kDa and by the presence of a SWADL domain that contains the sequence Ser-Trp-Ala-Asp-Leu. In malignant melanoma cells, gene expression is up-regulated in response to interferon alpha. In bone marrow-derived macrophages, expression of this gene is induced during activation by Toll-like receptor agonists and repressed during macrophage colony-stimulating factor-mediated differentiation. Myelopoiesis is disrupted by constitutive overexpression in myeloid-lineage cells. A pseudogene of this gene is found on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in Slfn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02052:Slfn4 APN 11 83186974 missense possibly damaging 0.94
IGL02455:Slfn4 APN 11 83186758 missense probably damaging 1.00
IGL02600:Slfn4 APN 11 83187006 missense possibly damaging 0.61
IGL03294:Slfn4 APN 11 83186574 missense probably benign 0.00
R0277:Slfn4 UTSW 11 83186951 missense probably damaging 0.96
R0323:Slfn4 UTSW 11 83186951 missense probably damaging 0.96
R0477:Slfn4 UTSW 11 83188681 missense probably benign 0.06
R1370:Slfn4 UTSW 11 83188806 missense probably damaging 1.00
R1449:Slfn4 UTSW 11 83188993 missense probably benign 0.00
R1757:Slfn4 UTSW 11 83185385 missense possibly damaging 0.47
R2392:Slfn4 UTSW 11 83185422 missense possibly damaging 0.77
R3738:Slfn4 UTSW 11 83185311 start codon destroyed probably null 0.02
R4025:Slfn4 UTSW 11 83187214 missense probably damaging 1.00
R4732:Slfn4 UTSW 11 83189282 unclassified probably benign
R4733:Slfn4 UTSW 11 83189282 unclassified probably benign
R4766:Slfn4 UTSW 11 83186821 missense possibly damaging 0.92
R4876:Slfn4 UTSW 11 83187018 missense probably benign 0.26
R4985:Slfn4 UTSW 11 83187207 missense probably damaging 0.98
R5033:Slfn4 UTSW 11 83186797 missense probably damaging 1.00
R5226:Slfn4 UTSW 11 83187549 missense possibly damaging 0.48
R5281:Slfn4 UTSW 11 83187199 missense probably damaging 1.00
R5337:Slfn4 UTSW 11 83189229 missense probably benign 0.35
R6207:Slfn4 UTSW 11 83189125 missense possibly damaging 0.82
R6237:Slfn4 UTSW 11 83189112 missense probably damaging 1.00
R6398:Slfn4 UTSW 11 83187174 missense possibly damaging 0.76
R7721:Slfn4 UTSW 11 83187563 splice site probably null
R7832:Slfn4 UTSW 11 83186593 missense probably damaging 0.96
R7975:Slfn4 UTSW 11 83187156 missense possibly damaging 0.79
R8092:Slfn4 UTSW 11 83189005 missense probably benign
R8279:Slfn4 UTSW 11 83186656 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAAGTGCATCCAACAGCTGC -3'
(R):5'- GCCATTGTGAAGGGAAAAGCTC -3'

Sequencing Primer
(F):5'- CAGCTGCCTGTCACTCAC -3'
(R):5'- TTGTGAAGGGAAAAGCTCACAGC -3'
Posted On2020-07-13