Incidental Mutation 'R8233:Krt14'
ID637232
Institutional Source Beutler Lab
Gene Symbol Krt14
Ensembl Gene ENSMUSG00000045545
Gene Namekeratin 14
SynonymsKrt1-14, K14, Cytokeratin 14, Krt-1.14, epidermolysis bullosa simplex, Dowling-Meara, Koebner
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location100203162-100207548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100203352 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 472 (V472A)
Ref Sequence ENSEMBL: ENSMUSP00000007272 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007272]
Predicted Effect probably damaging
Transcript: ENSMUST00000007272
AA Change: V472A

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000007272
Gene: ENSMUSG00000045545
AA Change: V472A

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Filament 120 431 5.67e-176 SMART
low complexity region 433 450 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the keratin family, the most diverse group of intermediate filaments. This gene product, a type I keratin, is usually found as a heterotetramer with two keratin 5 molecules, a type II keratin. Together they form the cytoskeleton of epithelial cells. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations develop extensive skin blistering after birth and die by 2 days of age. If keratin 16 is also expressed in skin, development is normal but later alopecia, chronic skin ulcers and stratified epithelial defects occur. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in Krt14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01759:Krt14 APN 11 100204416 splice site probably benign
R0449:Krt14 UTSW 11 100207395 missense unknown
R0848:Krt14 UTSW 11 100204264 missense probably damaging 1.00
R1302:Krt14 UTSW 11 100203347 missense probably damaging 1.00
R2024:Krt14 UTSW 11 100207218 missense unknown
R2088:Krt14 UTSW 11 100204123 missense possibly damaging 0.81
R2161:Krt14 UTSW 11 100207113 missense unknown
R3878:Krt14 UTSW 11 100207089 missense possibly damaging 0.56
R5015:Krt14 UTSW 11 100207206 nonsense probably null
R5314:Krt14 UTSW 11 100204700 missense probably damaging 1.00
R5474:Krt14 UTSW 11 100204745 missense probably damaging 1.00
R5698:Krt14 UTSW 11 100205625 missense probably benign 0.44
R5707:Krt14 UTSW 11 100204758 missense possibly damaging 0.77
R6072:Krt14 UTSW 11 100207166 missense unknown
R6523:Krt14 UTSW 11 100205097 missense possibly damaging 0.81
R6622:Krt14 UTSW 11 100203960 missense probably benign 0.00
R7082:Krt14 UTSW 11 100203341 missense possibly damaging 0.95
R7239:Krt14 UTSW 11 100204255 missense probably benign 0.03
R7350:Krt14 UTSW 11 100205100 nonsense probably null
R8055:Krt14 UTSW 11 100204758 missense possibly damaging 0.89
X0020:Krt14 UTSW 11 100205106 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GAGGCAGTGATTGTGCAACTC -3'
(R):5'- ACAGACTGGACTTGCAGCAG -3'

Sequencing Primer
(F):5'- CAGTGATTGTGCAACTCAGAAAAAG -3'
(R):5'- TGGACTTGCAGCAGGGAGTG -3'
Posted On2020-07-13