Incidental Mutation 'R8233:Lrrc74b'
ID637236
Institutional Source Beutler Lab
Gene Symbol Lrrc74b
Ensembl Gene ENSMUSG00000022759
Gene Nameleucine rich repeat containing 74B
Synonyms4930451C15Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.217) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location17544465-17561247 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 17558225 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 187 (H187L)
Ref Sequence ENSEMBL: ENSMUSP00000097699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023441] [ENSMUST00000023442] [ENSMUST00000065125] [ENSMUST00000100123] [ENSMUST00000168383] [ENSMUST00000171002]
Predicted Effect probably benign
Transcript: ENSMUST00000023441
SMART Domains Protein: ENSMUSP00000023441
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 385 7.9e-139 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023442
AA Change: H187L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000023442
Gene: ENSMUSG00000022759
AA Change: H187L

DomainStartEndE-ValueType
LRR 71 103 3.9e0 SMART
LRR 104 131 1.04e-3 SMART
LRR 132 159 1.14e1 SMART
LRR 160 187 7.78e-3 SMART
LRR 188 215 3.9e0 SMART
LRR 216 243 7.89e-1 SMART
LRR 244 271 6.78e-3 SMART
LRR 272 299 5.51e-1 SMART
low complexity region 342 355 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000065125
AA Change: H187L
SMART Domains Protein: ENSMUSP00000070127
Gene: ENSMUSG00000022759
AA Change: H187L

DomainStartEndE-ValueType
LRR 71 103 3.9e0 SMART
LRR 104 131 1.04e-3 SMART
LRR 132 159 1.14e1 SMART
LRR 160 187 7.78e-3 SMART
LRR 188 215 3.9e0 SMART
LRR 216 243 7.89e-1 SMART
LRR 244 271 6.78e-3 SMART
LRR 272 299 5.51e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100123
AA Change: H187L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000097699
Gene: ENSMUSG00000022759
AA Change: H187L

DomainStartEndE-ValueType
LRR 71 103 3.9e0 SMART
LRR 104 131 1.04e-3 SMART
LRR 132 159 1.14e1 SMART
LRR 160 187 7.78e-3 SMART
LRR 188 215 3.9e0 SMART
LRR 216 243 7.89e-1 SMART
LRR 244 271 6.78e-3 SMART
LRR 272 299 5.51e-1 SMART
LRR 300 327 4.16e0 SMART
low complexity region 374 387 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168383
SMART Domains Protein: ENSMUSP00000130079
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 266 4.2e-95 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171002
SMART Domains Protein: ENSMUSP00000132727
Gene: ENSMUSG00000022758

DomainStartEndE-ValueType
low complexity region 12 18 N/A INTRINSIC
Pfam:P2X_receptor 25 197 1e-65 PFAM
Pfam:P2X_receptor 185 362 7e-63 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503L19Rik A T 18: 70,469,616 V42E probably benign Het
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in Lrrc74b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01810:Lrrc74b APN 16 17545558 missense probably benign 0.00
IGL02402:Lrrc74b APN 16 17558164 splice site probably benign
P0043:Lrrc74b UTSW 16 17558159 splice site probably benign
R0131:Lrrc74b UTSW 16 17553152 missense probably damaging 1.00
R0131:Lrrc74b UTSW 16 17553152 missense probably damaging 1.00
R0132:Lrrc74b UTSW 16 17553152 missense probably damaging 1.00
R0829:Lrrc74b UTSW 16 17558390 splice site probably benign
R1463:Lrrc74b UTSW 16 17559873 missense probably benign 0.00
R1681:Lrrc74b UTSW 16 17559753 missense probably damaging 1.00
R1938:Lrrc74b UTSW 16 17553194 missense probably benign 0.41
R4790:Lrrc74b UTSW 16 17549853 missense probably damaging 1.00
R5428:Lrrc74b UTSW 16 17558261 missense probably damaging 0.99
R6198:Lrrc74b UTSW 16 17548786 missense probably damaging 0.96
R7910:Lrrc74b UTSW 16 17558349 nonsense probably null
X0063:Lrrc74b UTSW 16 17553208 missense probably benign 0.05
Z1177:Lrrc74b UTSW 16 17558168 critical splice donor site probably null
Z1177:Lrrc74b UTSW 16 17558172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATGCCTGGAACTCATTGAATTC -3'
(R):5'- CAGTATTGCTGCCCTCAGATG -3'

Sequencing Primer
(F):5'- GAACTCATTGAATTCCGTGGC -3'
(R):5'- CTCAGATGTGGACCTGTCAGAGAATC -3'
Posted On2020-07-13