Incidental Mutation 'R8233:4930503L19Rik'
ID637240
Institutional Source Beutler Lab
Gene Symbol 4930503L19Rik
Ensembl Gene ENSMUSG00000044906
Gene NameRIKEN cDNA 4930503L19 gene
SynonymsLas2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R8233 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location70452212-70472509 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70469616 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 42 (V42E)
Ref Sequence ENSEMBL: ENSMUSP00000065118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067556] [ENSMUST00000114959] [ENSMUST00000164223] [ENSMUST00000168249] [ENSMUST00000173951] [ENSMUST00000174118] [ENSMUST00000174667] [ENSMUST00000211817] [ENSMUST00000212074] [ENSMUST00000212155] [ENSMUST00000212539] [ENSMUST00000212683] [ENSMUST00000212982]
Predicted Effect probably benign
Transcript: ENSMUST00000067556
AA Change: V42E

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000065118
Gene: ENSMUSG00000044906
AA Change: V42E

DomainStartEndE-ValueType
low complexity region 15 40 N/A INTRINSIC
Pfam:LAS2 161 235 2.8e-26 PFAM
Pfam:LAS2 325 387 9.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114959
SMART Domains Protein: ENSMUSP00000110609
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164223
SMART Domains Protein: ENSMUSP00000126055
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168249
SMART Domains Protein: ENSMUSP00000130991
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173951
SMART Domains Protein: ENSMUSP00000134211
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
Blast:START 1 54 8e-18 BLAST
PDB:2MOU|A 1 54 3e-17 PDB
SCOP:d1em2a_ 1 54 2e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174118
SMART Domains Protein: ENSMUSP00000134511
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
START 6 208 8.76e-16 SMART
low complexity region 215 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174667
SMART Domains Protein: ENSMUSP00000133956
Gene: ENSMUSG00000079608

DomainStartEndE-ValueType
Pfam:START 4 98 9.6e-12 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000211817
AA Change: V42E
Predicted Effect probably benign
Transcript: ENSMUST00000212074
AA Change: V42E

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000212155
AA Change: V42E

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect possibly damaging
Transcript: ENSMUST00000212539
AA Change: V42E

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000212683
AA Change: V42E

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
Predicted Effect probably benign
Transcript: ENSMUST00000212982
AA Change: V42E

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,351,757 E153G probably benign Het
Adamts20 A C 15: 94,291,652 I1440S probably benign Het
Aspm T A 1: 139,457,304 S229T probably benign Het
Atp2b2 A T 6: 113,765,719 probably null Het
Cd101 G T 3: 100,993,673 H1032N unknown Het
Col6a2 A G 10: 76,608,706 probably null Het
Crot A T 5: 8,976,027 I320K possibly damaging Het
D5Ertd579e A T 5: 36,615,244 D602E probably damaging Het
Degs1 A G 1: 182,279,595 V69A probably benign Het
Dgkz A G 2: 91,939,649 S557P probably damaging Het
Fat1 T A 8: 44,952,018 L602Q Het
Gli2 A T 1: 118,844,437 Y513N probably damaging Het
Gm13762 C T 2: 88,973,738 R51H probably benign Het
H2-Q10 A G 17: 35,471,086 T202A probably benign Het
Hnrnpa3 A G 2: 75,662,516 N195D probably benign Het
Ifna1 C T 4: 88,850,391 T102I possibly damaging Het
Igfbp3 T A 11: 7,210,152 H167L probably benign Het
Igfn1 T C 1: 135,968,044 T1595A probably benign Het
Krt14 A G 11: 100,203,352 V472A probably damaging Het
Lrrc74b T A 16: 17,558,225 H187L probably benign Het
Magoh T G 4: 107,880,935 V44G possibly damaging Het
Mbnl1 A T 3: 60,625,130 I274L probably benign Het
Olfr60 T G 7: 140,345,498 M164L probably benign Het
Pdcd1 A G 1: 94,039,417 V252A probably damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Plcxd3 A G 15: 4,516,835 D107G possibly damaging Het
Polr2m T A 9: 71,483,584 D112V probably benign Het
Ptprn A T 1: 75,253,152 M701K probably damaging Het
Rxrb A G 17: 34,036,905 D421G possibly damaging Het
Slfn4 A G 11: 83,187,529 E381G probably damaging Het
Son AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG 16: 91,660,334 probably benign Het
Srgap1 A G 10: 121,825,436 I530T probably damaging Het
Stmn4 A G 14: 66,357,892 H122R probably damaging Het
Sycp2 T C 2: 178,356,634 E1031G probably damaging Het
Tle1 T C 4: 72,124,944 T553A probably benign Het
Tnik T A 3: 28,554,937 W217R unknown Het
Tyrp1 T C 4: 80,850,953 V161A unknown Het
Usp29 T A 7: 6,962,407 F416L probably benign Het
Usp45 T C 4: 21,781,736 V34A probably benign Het
Vmn1r119 A G 7: 21,012,007 V150A probably damaging Het
Other mutations in 4930503L19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00981:4930503L19Rik APN 18 70453333 nonsense probably null
IGL01549:4930503L19Rik APN 18 70468035 missense possibly damaging 0.46
R0119:4930503L19Rik UTSW 18 70469482 nonsense probably null
R0299:4930503L19Rik UTSW 18 70469482 nonsense probably null
R0554:4930503L19Rik UTSW 18 70467380 missense probably damaging 1.00
R0657:4930503L19Rik UTSW 18 70469482 nonsense probably null
R0973:4930503L19Rik UTSW 18 70467926 splice site probably null
R0973:4930503L19Rik UTSW 18 70467926 splice site probably null
R0974:4930503L19Rik UTSW 18 70467926 splice site probably null
R1710:4930503L19Rik UTSW 18 70468063 missense possibly damaging 0.83
R2046:4930503L19Rik UTSW 18 70467482 missense probably damaging 1.00
R2361:4930503L19Rik UTSW 18 70469575 missense probably damaging 1.00
R2936:4930503L19Rik UTSW 18 70468448 missense probably damaging 0.98
R5266:4930503L19Rik UTSW 18 70458384 missense probably damaging 1.00
R6317:4930503L19Rik UTSW 18 70468193 missense probably damaging 1.00
R6381:4930503L19Rik UTSW 18 70467717 missense probably damaging 1.00
R7108:4930503L19Rik UTSW 18 70468476 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TAAGGCGTACCATTGTCGGG -3'
(R):5'- TCCAGTGCTTATGTCGGATTATC -3'

Sequencing Primer
(F):5'- ACCATTGTCGGGTATATGTACGTAGC -3'
(R):5'- GCCTATCATCACTATTCATTGGCAC -3'
Posted On2020-07-13