Incidental Mutation 'R8234:Ackr1'
ID637244
Institutional Source Beutler Lab
Gene Symbol Ackr1
Ensembl Gene ENSMUSG00000037872
Gene Nameatypical chemokine receptor 1 (Duffy blood group)
SynonymsDarc, ESTM35, Dfy, FY, CCBP1, CD234
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8234 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location173331886-173333750 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 173332015 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 312 (R312S)
Ref Sequence ENSEMBL: ENSMUSP00000045134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005470] [ENSMUST00000038227] [ENSMUST00000111220] [ENSMUST00000194046]
Predicted Effect probably benign
Transcript: ENSMUST00000005470
SMART Domains Protein: ENSMUSP00000005470
Gene: ENSMUSG00000005338

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 67 159 1.43e-8 SMART
IG 169 262 6.31e-1 SMART
IGc2 277 338 3.91e-6 SMART
low complexity region 351 359 N/A INTRINSIC
4.1m 383 401 9.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038227
AA Change: R312S

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000045134
Gene: ENSMUSG00000037872
AA Change: R312S

DomainStartEndE-ValueType
SCOP:d1l9ha_ 26 317 1e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111220
SMART Domains Protein: ENSMUSP00000106851
Gene: ENSMUSG00000005338

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
IG 33 125 1.43e-8 SMART
IG 135 228 6.31e-1 SMART
IGc2 243 304 3.91e-6 SMART
low complexity region 317 325 N/A INTRINSIC
4.1m 349 367 9.24e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000194046
SMART Domains Protein: ENSMUSP00000141765
Gene: ENSMUSG00000037872

DomainStartEndE-ValueType
transmembrane domain 59 81 N/A INTRINSIC
transmembrane domain 96 118 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a glycosylated membrane protein and a non-specific receptor for several chemokines. The encoded protein is the receptor for the human malarial parasites Plasmodium vivax and Plasmodium knowlesi. Polymorphisms in this gene are the basis of the Duffy blood group system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are healthy, but erythrocytes lack CXC and CC chemokine-binding activity, such that when challenged with LPS result in increased inflammatory infiltrates in lung and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,753,510 S1180P possibly damaging Het
Abhd4 T A 14: 54,261,676 M38K probably benign Het
Agpat9 T C 5: 100,857,210 probably null Het
Akap9 T C 5: 4,044,845 V2213A probably benign Het
Alox5 T A 6: 116,413,874 R439W probably damaging Het
Atrn A T 2: 131,023,000 probably null Het
Casd1 A G 6: 4,601,209 N14S probably damaging Het
Cry2 T C 2: 92,412,629 S542G probably benign Het
Cyb5rl A G 4: 107,068,738 Y39C probably damaging Het
Dmpk A T 7: 19,088,123 K335N probably benign Het
Dnaic1 A G 4: 41,625,221 D395G probably benign Het
Dock4 C T 12: 40,834,838 probably null Het
Fmo4 T C 1: 162,805,188 D198G probably damaging Het
Foxc2 G A 8: 121,118,038 R475Q probably damaging Het
Gipr C A 7: 19,164,608 G37V unknown Het
Gm15800 T A 5: 121,339,544 N2843K possibly damaging Het
Gm2046 A T 12: 87,973,738 I71L noncoding transcript Het
Hcn4 A G 9: 58,844,150 D353G unknown Het
Hmcn1 C T 1: 150,594,010 V4973M possibly damaging Het
Il20rb C T 9: 100,459,210 S281N probably benign Het
Kcnh4 A T 11: 100,752,267 N391K possibly damaging Het
Kitl A G 10: 100,051,846 T6A probably damaging Het
Krt36 A G 11: 100,104,201 Y182H probably damaging Het
Lrp1b T G 2: 41,312,656 I1262L Het
Mtf1 A G 4: 124,844,246 E644G probably benign Het
Mtx2 A G 2: 74,869,362 Y159C probably damaging Het
Nags C T 11: 102,148,998 S504F probably damaging Het
Ncam1 A T 9: 49,545,223 F475L probably damaging Het
Nipal2 G T 15: 34,600,032 T213N possibly damaging Het
Olfr1098 A G 2: 86,922,969 S188P probably damaging Het
Olfr554 T A 7: 102,640,471 L75Q probably damaging Het
Pkm T C 9: 59,670,599 V233A possibly damaging Het
Pros1 T A 16: 62,928,177 I671N possibly damaging Het
Rasd1 T C 11: 59,964,292 I121V probably damaging Het
Samhd1 A G 2: 157,116,350 probably null Het
Serpinb9f A T 13: 33,325,915 Y30F probably benign Het
Slc5a10 T C 11: 61,673,281 I543V probably benign Het
Stat5a A G 11: 100,879,303 I469V possibly damaging Het
Sugct T C 13: 16,857,874 E431G probably benign Het
Tecr C A 8: 83,573,251 R133L possibly damaging Het
Tiparp A G 3: 65,531,581 N106S probably benign Het
Triml1 T C 8: 43,141,248 S49G probably benign Het
Trpm3 T A 19: 22,715,276 S244T possibly damaging Het
Ttn T C 2: 76,722,980 D31055G probably damaging Het
Vcp A T 4: 42,985,242 I369N probably damaging Het
Vmn2r110 A C 17: 20,584,429 N76K probably benign Het
Vmn2r12 T C 5: 109,086,208 T713A probably benign Het
Vmn2r17 A T 5: 109,453,369 K844N probably benign Het
Other mutations in Ackr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02093:Ackr1 APN 1 173332829 missense probably benign 0.23
R0479:Ackr1 UTSW 1 173332145 missense probably benign 0.02
R1664:Ackr1 UTSW 1 173332866 missense probably benign 0.36
R1713:Ackr1 UTSW 1 173332349 missense probably benign 0.38
R2273:Ackr1 UTSW 1 173332485 missense probably benign 0.17
R2274:Ackr1 UTSW 1 173332485 missense probably benign 0.17
R2275:Ackr1 UTSW 1 173332485 missense probably benign 0.17
R4469:Ackr1 UTSW 1 173332545 splice site probably null
R5871:Ackr1 UTSW 1 173332073 missense probably damaging 0.99
R6523:Ackr1 UTSW 1 173332553 critical splice donor site probably null
R7062:Ackr1 UTSW 1 173332115 missense possibly damaging 0.68
R7751:Ackr1 UTSW 1 173332212 missense probably damaging 0.96
R8477:Ackr1 UTSW 1 173332188 missense probably damaging 1.00
R8697:Ackr1 UTSW 1 173332208 missense probably damaging 0.96
R8738:Ackr1 UTSW 1 173332385 missense probably damaging 0.97
R8851:Ackr1 UTSW 1 173332116 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- TCCAGGACAGCTCTAAGGAC -3'
(R):5'- CATTTTCTGGTGGCCTCATG -3'

Sequencing Primer
(F):5'- CAGCTCTAAGGACAGGAAAGG -3'
(R):5'- GCCTCATGGGATGGTTCTC -3'
Posted On2020-07-13