Mutagenetix > Incidental Mutations

Incidental Mutation 'R8234:Cry2'

637249

Institutional Source

Beutler Lab

Gene Symbol

Cry2

Ensembl Gene

ENSMUSG00000068742

Gene Name

cryptochrome 2 (photolyase-like)

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.752) question?

Stock #

R8234 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92403646-92434043 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 92412629 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 542 (S542G)

Ref Sequence

ENSEMBL: ENSMUSP00000088047 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090559] [ENSMUST00000111278]

AlphaFold

Q9R194

PDB Structure

A vertebrate cryptochrome [X-RAY DIFFRACTION]
a vertebrate cryptochrome with FAD [X-RAY DIFFRACTION]
A ubiquitin ligase-substrate complex [X-RAY DIFFRACTION]
Mammalian cryptochrome in complex with a small molecule competitor of its ubiquitin ligase [X-RAY DIFFRACTION]
Crystal Structure of Mammalian Period-Cryptochrome Complex [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000090559
AA Change: S542G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000088047
Gene: ENSMUSG00000068742
AA Change: S542G

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:DNA_photolyase	23	187	2.4e-50	PFAM
Pfam:FAD_binding_7	231	504	4.4e-89	PFAM
low complexity region	562	573	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000111278
AA Change: S542G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106909
Gene: ENSMUSG00000068742
AA Change: S542G

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:DNA_photolyase	23	189	3.6e-50	PFAM
Pfam:FAD_binding_7	230	506	1.4e-105	PFAM
low complexity region	562	573	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour longer circadian period under constant darkness, and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	C	1: 105,753,510	S1180P	possibly damaging	Het
Abhd4	T	A	14: 54,261,676	M38K	probably benign	Het
Ackr1	T	A	1: 173,332,015	R312S	probably benign	Het
Agpat9	T	C	5: 100,857,210		probably null	Het
Akap9	T	C	5: 4,044,845	V2213A	probably benign	Het
Alox5	T	A	6: 116,413,874	R439W	probably damaging	Het
Atrn	A	T	2: 131,023,000		probably null	Het
Casd1	A	G	6: 4,601,209	N14S	probably damaging	Het
Cyb5rl	A	G	4: 107,068,738	Y39C	probably damaging	Het
Dmpk	A	T	7: 19,088,123	K335N	probably benign	Het
Dnaic1	A	G	4: 41,625,221	D395G	probably benign	Het
Dock4	C	T	12: 40,834,838		probably null	Het
Fmo4	T	C	1: 162,805,188	D198G	probably damaging	Het
Foxc2	G	A	8: 121,118,038	R475Q	probably damaging	Het
Gipr	C	A	7: 19,164,608	G37V	unknown	Het
Gm15800	T	A	5: 121,339,544	N2843K	possibly damaging	Het
Gm2046	A	T	12: 87,973,738	I71L	noncoding transcript	Het
Hcn4	A	G	9: 58,844,150	D353G	unknown	Het
Hmcn1	C	T	1: 150,594,010	V4973M	possibly damaging	Het
Il20rb	C	T	9: 100,459,210	S281N	probably benign	Het
Kcnh4	A	T	11: 100,752,267	N391K	possibly damaging	Het
Kitl	A	G	10: 100,051,846	T6A	probably damaging	Het
Krt36	A	G	11: 100,104,201	Y182H	probably damaging	Het
Lrp1b	T	G	2: 41,312,656	I1262L		Het
Mtf1	A	G	4: 124,844,246	E644G	probably benign	Het
Mtx2	A	G	2: 74,869,362	Y159C	probably damaging	Het
Nags	C	T	11: 102,148,998	S504F	probably damaging	Het
Ncam1	A	T	9: 49,545,223	F475L	probably damaging	Het
Nipal2	G	T	15: 34,600,032	T213N	possibly damaging	Het
Olfr1098	A	G	2: 86,922,969	S188P	probably damaging	Het
Olfr554	T	A	7: 102,640,471	L75Q	probably damaging	Het
Pkm	T	C	9: 59,670,599	V233A	possibly damaging	Het
Pros1	T	A	16: 62,928,177	I671N	possibly damaging	Het
Rasd1	T	C	11: 59,964,292	I121V	probably damaging	Het
Samhd1	A	G	2: 157,116,350		probably null	Het
Serpinb9f	A	T	13: 33,325,915	Y30F	probably benign	Het
Slc5a10	T	C	11: 61,673,281	I543V	probably benign	Het
Stat5a	A	G	11: 100,879,303	I469V	possibly damaging	Het
Sugct	T	C	13: 16,857,874	E431G	probably benign	Het
Tecr	C	A	8: 83,573,251	R133L	possibly damaging	Het
Tiparp	A	G	3: 65,531,581	N106S	probably benign	Het
Triml1	T	C	8: 43,141,248	S49G	probably benign	Het
Trpm3	T	A	19: 22,715,276	S244T	possibly damaging	Het
Ttn	T	C	2: 76,722,980	D31055G	probably damaging	Het
Vcp	A	T	4: 42,985,242	I369N	probably damaging	Het
Vmn2r110	A	C	17: 20,584,429	N76K	probably benign	Het
Vmn2r12	T	C	5: 109,086,208	T713A	probably benign	Het
Vmn2r17	A	T	5: 109,453,369	K844N	probably benign	Het

Other mutations in Cry2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01995:Cry2	APN	2	92424632	missense	probably benign	0.15
IGL02167:Cry2	APN	2	92433821	missense	possibly damaging	0.93
IGL02183:Cry2	APN	2	92413039	missense	probably damaging	0.99
IGL02343:Cry2	APN	2	92426921	missense	possibly damaging	0.90
IGL02432:Cry2	APN	2	92413667	missense	probably damaging	0.99
IGL02725:Cry2	APN	2	92413260	splice site	probably benign
IGL02932:Cry2	APN	2	92413117	nonsense	probably null
IGL03122:Cry2	APN	2	92413295	missense	probably damaging	1.00
IGL03366:Cry2	APN	2	92413715	missense	probably damaging	1.00
R0679:Cry2	UTSW	2	92413715	missense	probably damaging	1.00
R1325:Cry2	UTSW	2	92413770	missense	probably damaging	1.00
R1862:Cry2	UTSW	2	92424566	missense	probably damaging	1.00
R1891:Cry2	UTSW	2	92413640	missense	possibly damaging	0.93
R2189:Cry2	UTSW	2	92411692	missense	possibly damaging	0.84
R4032:Cry2	UTSW	2	92413827	missense	probably benign	0.00
R4689:Cry2	UTSW	2	92424554	missense	probably benign	0.38
R5130:Cry2	UTSW	2	92424599	missense	probably benign	0.28
R5145:Cry2	UTSW	2	92413060	missense	probably benign
R5970:Cry2	UTSW	2	92412967	missense	probably benign	0.08
R6179:Cry2	UTSW	2	92413842	missense	probably damaging	0.98
R7102:Cry2	UTSW	2	92413093	missense	probably damaging	0.99
R7158:Cry2	UTSW	2	92413715	missense	probably damaging	1.00
R7213:Cry2	UTSW	2	92413659	missense	probably benign	0.00
R7257:Cry2	UTSW	2	92412981	missense	possibly damaging	0.67
R7378:Cry2	UTSW	2	92413664	missense	probably damaging	1.00
R7427:Cry2	UTSW	2	92413047	missense	possibly damaging	0.74
R7428:Cry2	UTSW	2	92413047	missense	possibly damaging	0.74
R7440:Cry2	UTSW	2	92413638	missense	probably damaging	1.00
R7531:Cry2	UTSW	2	92413005	missense	probably damaging	0.98
R8350:Cry2	UTSW	2	92413941	missense	probably benign	0.00
R8450:Cry2	UTSW	2	92413941	missense	probably benign	0.00
R8496:Cry2	UTSW	2	92426939	missense	probably damaging	1.00
R9172:Cry2	UTSW	2	92413648	missense	probably damaging	1.00
R9283:Cry2	UTSW	2	92413904	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGCCACTCAGTGCTACCTC -3'
(R):5'- TGTAAAAGATGCTGCAGGCTG -3'

Sequencing Primer
(F):5'- GCTACCTCCCTCCAAAATCCTTAATG -3'
(R):5'- CCAGATTGGGCTGCCAAAG -3'

Posted On

2020-07-13