Mutagenetix > Incidental Mutation

Incidental Mutation 'R0718:Bicd2'

63726

Institutional Source

Beutler Lab

Gene Symbol

Bicd2

Ensembl Gene

ENSMUSG00000037933

Gene Name

BICD cargo adaptor 2

Synonyms

0610027D24Rik, 1110005D12Rik

MMRRC Submission

038900-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.709) question?

Stock #

R0718 (G1)

Quality Score

112

Status

Validated

Chromosome

Chromosomal Location

49341585-49387026 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 49377875 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000105712 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048544] [ENSMUST00000110084] [ENSMUST00000110085]

AlphaFold

Q921C5

Predicted Effect

probably null
Transcript: ENSMUST00000048544

SMART Domains

Protein: ENSMUSP00000039394
Gene: ENSMUSG00000037933

Domain	Start	End	E-Value	Type
internal_repeat_1	22	50	2.25e-5	PROSPERO
Pfam:BicD	83	797	N/A	PFAM
low complexity region	807	819	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110084

SMART Domains

Protein: ENSMUSP00000105711
Gene: ENSMUSG00000037933

Domain	Start	End	E-Value	Type
Pfam:BicD	9	723	N/A	PFAM
low complexity region	733	745	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000110085

SMART Domains

Protein: ENSMUSP00000105712
Gene: ENSMUSG00000037933

Domain	Start	End	E-Value	Type
internal_repeat_1	22	50	1.16e-5	PROSPERO
Pfam:BicD	83	797	N/A	PFAM
low complexity region	807	819	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.6%
20x: 95.9%

Validation Efficiency

100% (96/96)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D and a member of the Bicoid family. It has been implicated in dynein-mediated, minus end-directed motility along microtubules. It has also been reported to be a phosphorylation target of NIMA related kinase 8. Two alternative splice variants have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show postnatal and premature death associated with progressive hydrocephalus, enlarged lateral ventricles, aqueductal stenosis, abnormal gait, disrupted laminar organization of the cerebral cortex and cerebellum, and impaired cerebellar granule cell migration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamtsl4	A	T	3: 95,679,608	Y811N	possibly damaging	Het
Adrm1	T	C	2: 180,175,147		probably benign	Het
Alms1	T	A	6: 85,621,821	S1210T	probably benign	Het
Ampd3	C	T	7: 110,777,808	P11L	probably damaging	Het
Arhgap5	A	G	12: 52,516,507	E87G	possibly damaging	Het
Armc5	C	T	7: 128,240,070		probably benign	Het
Asic2	C	G	11: 80,971,456		probably benign	Het
Asph	A	G	4: 9,514,683		probably benign	Het
Brip1	A	G	11: 86,143,305	L530P	possibly damaging	Het
Bsn	G	T	9: 108,111,360		probably benign	Het
Btnl4	T	A	17: 34,469,634	H390L	probably benign	Het
Ccdc70	A	C	8: 21,973,308	K38T	probably damaging	Het
Ccni	G	A	5: 93,202,316	P35S	probably benign	Het
Cdh17	A	G	4: 11,810,451	D714G	possibly damaging	Het
Cenpf	A	G	1: 189,653,984	L2033P	probably damaging	Het
Cfap69	A	T	5: 5,621,924	M328K	probably damaging	Het
Cmah	T	G	13: 24,417,210		probably null	Het
Cog6	T	C	3: 53,010,629	T163A	probably benign	Het
Cyp2j8	G	A	4: 96,501,196	S130F	probably benign	Het
Dgki	A	G	6: 37,012,896	V636A	probably damaging	Het
Dmkn	T	A	7: 30,764,786		probably benign	Het
Dnah6	A	G	6: 73,035,293	I3679T	possibly damaging	Het
Dsp	A	T	13: 38,196,764	Y2495F	possibly damaging	Het
Exosc4	C	T	15: 76,329,489	A171V	probably benign	Het
Fbxw24	A	G	9: 109,623,509		probably benign	Het
Flvcr1	A	T	1: 191,025,582	L171Q	probably damaging	Het
Fsd1	G	T	17: 55,996,445		probably null	Het
Gm7732	A	G	17: 21,129,844		noncoding transcript	Het
H2-K2	A	C	17: 33,975,623		noncoding transcript	Het
Hgf	A	G	5: 16,593,859	N295S	probably damaging	Het
Ift88	T	A	14: 57,517,413	D811E	probably benign	Het
Igsf9b	T	A	9: 27,323,361		probably null	Het
Immt	T	A	6: 71,863,172	V311E	probably damaging	Het
Ipo11	T	A	13: 106,919,611	N51I	possibly damaging	Het
Isy1	T	C	6: 87,819,176	K260E	probably damaging	Het
Jchain	T	G	5: 88,526,202	I28L	probably benign	Het
Jmjd1c	T	A	10: 67,218,946		probably null	Het
Kif13b	T	C	14: 64,751,662		probably benign	Het
Klhdc7b	T	C	15: 89,388,169	Y427H	possibly damaging	Het
Klhl8	T	C	5: 103,876,293		probably benign	Het
Lrp2	C	T	2: 69,510,948	D963N	probably damaging	Het
Ltbp3	G	T	19: 5,746,748		probably benign	Het
Ltf	C	A	9: 111,040,379	Q41K	probably benign	Het
Med4	T	A	14: 73,516,657	I148N	probably damaging	Het
Mlh3	T	G	12: 85,247,697	S1242R	possibly damaging	Het
Mllt6	T	C	11: 97,676,359		probably benign	Het
Mpdz	A	G	4: 81,292,473	I1712T	possibly damaging	Het
Mrgprb4	T	A	7: 48,198,553	H209L	probably benign	Het
Nkapl	A	T	13: 21,468,440	M1K	probably null	Het
Nmur2	T	A	11: 56,029,498		probably benign	Het
Nsun2	T	A	13: 69,543,697		probably benign	Het
Olfr1082	G	A	2: 86,594,081	T249I	probably benign	Het
Olfr1130	A	G	2: 87,607,927	I180V	probably benign	Het
Ovgp1	T	C	3: 105,974,830		probably benign	Het
Pcdh8	A	G	14: 79,770,691	V144A	possibly damaging	Het
Pcnx3	G	A	19: 5,677,728		probably benign	Het
Pla2r1	C	A	2: 60,479,530	V570L	possibly damaging	Het
Plxnd1	C	A	6: 115,966,638	E1202D	possibly damaging	Het
Ppp1r37	T	C	7: 19,532,254	E529G	probably benign	Het
Prdm15	A	G	16: 97,812,633	F496L	possibly damaging	Het
Prlhr	A	T	19: 60,468,005	V41D	probably benign	Het
Prlhr	G	T	19: 60,468,059	S23*	probably null	Het
Prpf4	C	T	4: 62,414,540		probably benign	Het
Psg26	C	T	7: 18,475,235	R416H	probably benign	Het
Psg26	T	C	7: 18,478,287	H381R	probably benign	Het
Ralgds	T	G	2: 28,549,116	M717R	probably benign	Het
Rbms1	T	C	2: 60,842,412	N44D	probably damaging	Het
Rpa1	T	C	11: 75,318,401		probably benign	Het
Rprd2	T	C	3: 95,766,387	N568S	probably benign	Het
Rptor	A	G	11: 119,872,376	M929V	probably benign	Het
Rspo1	T	A	4: 125,007,149	C97S	possibly damaging	Het
Scin	C	T	12: 40,079,607	G396S	probably damaging	Het
Scn9a	T	C	2: 66,547,112	N409D	probably damaging	Het
Sf3b1	A	G	1: 55,019,385	I15T	probably damaging	Het
Sh3bp2	T	C	5: 34,555,495	V149A	probably damaging	Het
Slc39a12	T	A	2: 14,407,426		probably benign	Het
Sp9	G	T	2: 73,273,827	A242S	possibly damaging	Het
Srr	A	G	11: 74,911,065	V126A	possibly damaging	Het
Tatdn3	G	T	1: 191,052,849		probably benign	Het
Tex14	G	A	11: 87,499,613	V379I	probably benign	Het
Tmed6	T	C	8: 107,061,724	N197S	probably damaging	Het
Ttbk2	G	A	2: 120,748,575	L689F	probably benign	Het
Ttbk2	A	T	2: 120,745,160	I1043N	probably benign	Het
Ttn	A	G	2: 76,810,696	S5283P	probably damaging	Het
Ube3b	C	A	5: 114,402,555	S441*	probably null	Het
Ush2a	G	A	1: 188,797,830	C3272Y	probably damaging	Het
Vac14	T	A	8: 110,632,477	I95K	probably damaging	Het
Vangl2	G	A	1: 172,006,217	A433V	probably damaging	Het
Vwa5b1	A	T	4: 138,608,824	V153D	probably damaging	Het
Zfhx3	T	A	8: 108,955,650	D3240E	unknown	Het
Zfp945	A	G	17: 22,851,030	C632R	probably damaging	Het
Zfyve26	G	A	12: 79,265,802		probably benign	Het
Zyg11b	A	T	4: 108,242,076	I606N	possibly damaging	Het

Other mutations in Bicd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01070:Bicd2	APN	13	49378316	missense	probably damaging	1.00
IGL02029:Bicd2	APN	13	49369499	missense	probably damaging	1.00
IGL02052:Bicd2	APN	13	49379189	missense	possibly damaging	0.91
IGL02955:Bicd2	APN	13	49378215	missense	probably benign
IGL03033:Bicd2	APN	13	49379920	missense	probably benign	0.09
IGL03395:Bicd2	APN	13	49375258	missense	probably damaging	1.00
IGL02802:Bicd2	UTSW	13	49378328	missense	probably damaging	1.00
P0027:Bicd2	UTSW	13	49379651	missense	probably benign	0.05
R0052:Bicd2	UTSW	13	49375314	missense	probably damaging	1.00
R0052:Bicd2	UTSW	13	49375314	missense	probably damaging	1.00
R0393:Bicd2	UTSW	13	49379870	missense	probably damaging	1.00
R0730:Bicd2	UTSW	13	49378241	missense	possibly damaging	0.77
R1716:Bicd2	UTSW	13	49378310	missense	probably benign
R2004:Bicd2	UTSW	13	49379405	missense	possibly damaging	0.50
R2041:Bicd2	UTSW	13	49341776	missense	probably benign	0.02
R2151:Bicd2	UTSW	13	49379576	missense	probably damaging	1.00
R2152:Bicd2	UTSW	13	49379576	missense	probably damaging	1.00
R2444:Bicd2	UTSW	13	49379024	missense	probably benign	0.00
R4085:Bicd2	UTSW	13	49384962	splice site	probably null
R4477:Bicd2	UTSW	13	49377972	missense	probably damaging	1.00
R4824:Bicd2	UTSW	13	49379012	missense	probably damaging	1.00
R4979:Bicd2	UTSW	13	49379464	missense	possibly damaging	0.89
R6348:Bicd2	UTSW	13	49379846	missense	probably damaging	1.00
R7317:Bicd2	UTSW	13	49378308	missense	probably damaging	1.00
R7326:Bicd2	UTSW	13	49369609	missense	probably benign	0.43
R7395:Bicd2	UTSW	13	49378230	missense	possibly damaging	0.79
R7448:Bicd2	UTSW	13	49379951	missense	probably damaging	1.00
R7789:Bicd2	UTSW	13	49379659	missense	probably damaging	1.00
R8082:Bicd2	UTSW	13	49379053	nonsense	probably null
R8247:Bicd2	UTSW	13	49379986	missense	probably damaging	1.00
R8726:Bicd2	UTSW	13	49379429	missense	probably damaging	0.99
T0722:Bicd2	UTSW	13	49379651	missense	probably benign	0.05
X0003:Bicd2	UTSW	13	49379651	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ACTTCTAGTGCTCTAGATGGCCCC -3'
(R):5'- TGCTCATGTAGTGCGACAACTCC -3'

Sequencing Primer
(F):5'- TAGATGGCCCCTCCTAGC -3'
(R):5'- CGCAGGTTGTTCTTCTGCTC -3'

Posted On

2013-07-30