Incidental Mutation 'R8234:Dmpk'
ID637265
Institutional Source Beutler Lab
Gene Symbol Dmpk
Ensembl Gene ENSMUSG00000030409
Gene Namedystrophia myotonica-protein kinase
SynonymsDM, Dm15
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_032418.2, NM_001190490.1, NM_001190491.1; MGI: 94906

Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock #R8234 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location19083849-19093821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 19088123 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 335 (K335N)
Ref Sequence ENSEMBL: ENSMUSP00000104113 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032568] [ENSMUST00000108473] [ENSMUST00000108474] [ENSMUST00000122999] [ENSMUST00000154199]
Predicted Effect probably benign
Transcript: ENSMUST00000032568
AA Change: K335N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000032568
Gene: ENSMUSG00000030409
AA Change: K335N

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 6.5e-87 SMART
S_TK_X 340 407 3.6e-11 SMART
Pfam:DMPK_coil 472 532 2.8e-25 PFAM
low complexity region 590 613 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108473
AA Change: K335N

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000104113
Gene: ENSMUSG00000030409
AA Change: K335N

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 407 7.5e-9 SMART
Pfam:DMPK_coil 472 532 2.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108474
SMART Domains Protein: ENSMUSP00000104114
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 336 2.57e-76 SMART
Pfam:DMPK_coil 446 506 2.4e-28 PFAM
low complexity region 564 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122999
SMART Domains Protein: ENSMUSP00000123516
Gene: ENSMUSG00000030409

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
PDB:2VD5|B 32 139 3e-62 PDB
SCOP:d1koba_ 44 139 3e-21 SMART
Blast:S_TKc 71 139 7e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154199
AA Change: K335N

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000118459
Gene: ENSMUSG00000030409
AA Change: K335N

DomainStartEndE-ValueType
low complexity region 5 31 N/A INTRINSIC
S_TKc 71 339 1.36e-84 SMART
S_TK_X 340 402 5.3e-9 SMART
Pfam:DMPK_coil 467 527 2.3e-28 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (49/49)
MGI Phenotype Strain: 3054407; 2182402
FUNCTION: The protein encoded by this gene is a serine/threonine protein kinase that contains coiled-coil and C-terminal membrane association domains. In the embryonic mouse, it is found in cardiac and skeletal myocytes where it appears to play a role in myogenesis. In adults, the transcript is localized to several tissues including brain, heart, and skeletal and smooth muscle, and a function in cytoskeletal remodeling has been described. Transcripts with expanded CUG repeats in the 3' untranslated region mediate alternative splicing of several genes and sequester RNA binding proteins and RNA transcripts that contain CAG repeats, resulting in myotonic dystrophy, an autosomal dominant neuromuscular disorder. Alternative splicing results in multiple protein coding and non-coding transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Homozygotes for a null mutation exhibit abnormal sodium channel gating in cardiac myocytes, cardiac conduction defects, and late-onset progressive skeletal myopathy. Homozygotes for a second null mutation do not develop skeletal myopathy but do have abnormal muscle intracellular calcium levels. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,753,510 S1180P possibly damaging Het
Abhd4 T A 14: 54,261,676 M38K probably benign Het
Ackr1 T A 1: 173,332,015 R312S probably benign Het
Agpat9 T C 5: 100,857,210 probably null Het
Akap9 T C 5: 4,044,845 V2213A probably benign Het
Alox5 T A 6: 116,413,874 R439W probably damaging Het
Atrn A T 2: 131,023,000 probably null Het
Casd1 A G 6: 4,601,209 N14S probably damaging Het
Cry2 T C 2: 92,412,629 S542G probably benign Het
Cyb5rl A G 4: 107,068,738 Y39C probably damaging Het
Dnaic1 A G 4: 41,625,221 D395G probably benign Het
Dock4 C T 12: 40,834,838 probably null Het
Fmo4 T C 1: 162,805,188 D198G probably damaging Het
Foxc2 G A 8: 121,118,038 R475Q probably damaging Het
Gipr C A 7: 19,164,608 G37V unknown Het
Gm15800 T A 5: 121,339,544 N2843K possibly damaging Het
Gm2046 A T 12: 87,973,738 I71L noncoding transcript Het
Hcn4 A G 9: 58,844,150 D353G unknown Het
Hmcn1 C T 1: 150,594,010 V4973M possibly damaging Het
Il20rb C T 9: 100,459,210 S281N probably benign Het
Kcnh4 A T 11: 100,752,267 N391K possibly damaging Het
Kitl A G 10: 100,051,846 T6A probably damaging Het
Krt36 A G 11: 100,104,201 Y182H probably damaging Het
Lrp1b T G 2: 41,312,656 I1262L Het
Mtf1 A G 4: 124,844,246 E644G probably benign Het
Mtx2 A G 2: 74,869,362 Y159C probably damaging Het
Nags C T 11: 102,148,998 S504F probably damaging Het
Ncam1 A T 9: 49,545,223 F475L probably damaging Het
Nipal2 G T 15: 34,600,032 T213N possibly damaging Het
Olfr1098 A G 2: 86,922,969 S188P probably damaging Het
Olfr554 T A 7: 102,640,471 L75Q probably damaging Het
Pkm T C 9: 59,670,599 V233A possibly damaging Het
Pros1 T A 16: 62,928,177 I671N possibly damaging Het
Rasd1 T C 11: 59,964,292 I121V probably damaging Het
Samhd1 A G 2: 157,116,350 probably null Het
Serpinb9f A T 13: 33,325,915 Y30F probably benign Het
Slc5a10 T C 11: 61,673,281 I543V probably benign Het
Stat5a A G 11: 100,879,303 I469V possibly damaging Het
Sugct T C 13: 16,857,874 E431G probably benign Het
Tecr C A 8: 83,573,251 R133L possibly damaging Het
Tiparp A G 3: 65,531,581 N106S probably benign Het
Triml1 T C 8: 43,141,248 S49G probably benign Het
Trpm3 T A 19: 22,715,276 S244T possibly damaging Het
Ttn T C 2: 76,722,980 D31055G probably damaging Het
Vcp A T 4: 42,985,242 I369N probably damaging Het
Vmn2r110 A C 17: 20,584,429 N76K probably benign Het
Vmn2r12 T C 5: 109,086,208 T713A probably benign Het
Vmn2r17 A T 5: 109,453,369 K844N probably benign Het
Other mutations in Dmpk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02198:Dmpk APN 7 19088192 missense probably damaging 0.98
IGL02874:Dmpk APN 7 19087001 missense possibly damaging 0.75
IGL02942:Dmpk APN 7 19092241 missense probably damaging 0.99
IGL03081:Dmpk APN 7 19087533 missense probably damaging 1.00
IGL03258:Dmpk APN 7 19092206 critical splice acceptor site probably null
IGL03302:Dmpk APN 7 19086486 splice site probably benign
P0008:Dmpk UTSW 7 19088062 missense possibly damaging 0.89
R0388:Dmpk UTSW 7 19084077 unclassified probably benign
R0961:Dmpk UTSW 7 19087270 missense probably damaging 0.99
R3103:Dmpk UTSW 7 19087654 missense probably damaging 1.00
R3157:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3158:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3159:Dmpk UTSW 7 19093019 missense probably benign 0.00
R3498:Dmpk UTSW 7 19086381 missense probably damaging 1.00
R4696:Dmpk UTSW 7 19088214 missense probably damaging 1.00
R4830:Dmpk UTSW 7 19087528 missense probably damaging 1.00
R4991:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5156:Dmpk UTSW 7 19084125 missense probably damaging 1.00
R5169:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5170:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5171:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5172:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5198:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5200:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5202:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5205:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5383:Dmpk UTSW 7 19088019 missense probably benign 0.05
R5449:Dmpk UTSW 7 19090991 missense probably benign 0.18
R5639:Dmpk UTSW 7 19092600 missense probably benign 0.22
R5874:Dmpk UTSW 7 19092082 intron probably benign
R6939:Dmpk UTSW 7 19088224 missense probably damaging 0.97
R7133:Dmpk UTSW 7 19087307 missense probably damaging 1.00
R7352:Dmpk UTSW 7 19086072 missense probably damaging 0.98
R8032:Dmpk UTSW 7 19088053 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GACTTAGTGGCTTGTGCTCC -3'
(R):5'- TTTTATGGAAGAGGCTAGGGAAGTC -3'

Sequencing Primer
(F):5'- TGGGAAACAGAACCTTGATCACTCTG -3'
(R):5'- GGAAGTCCCCTCAACGGATCAG -3'
Posted On2020-07-13