Incidental Mutation 'R8234:Olfr554'
ID637266
Institutional Source Beutler Lab
Gene Symbol Olfr554
Ensembl Gene ENSMUSG00000073971
Gene Nameolfactory receptor 554
SynonymsGA_x6K02T2PBJ9-5356887-5357840, MOR25-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R8234 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location102638432-102642555 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 102640471 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 75 (L75Q)
Ref Sequence ENSEMBL: ENSMUSP00000095824 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098221]
Predicted Effect probably damaging
Transcript: ENSMUST00000098221
AA Change: L75Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095824
Gene: ENSMUSG00000073971
AA Change: L75Q

DomainStartEndE-ValueType
Pfam:7tm_4 33 313 3.3e-108 PFAM
Pfam:7TM_GPCR_Srsx 37 152 4.7e-10 PFAM
Pfam:7tm_1 43 295 1.7e-18 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,753,510 S1180P possibly damaging Het
Abhd4 T A 14: 54,261,676 M38K probably benign Het
Ackr1 T A 1: 173,332,015 R312S probably benign Het
Agpat9 T C 5: 100,857,210 probably null Het
Akap9 T C 5: 4,044,845 V2213A probably benign Het
Alox5 T A 6: 116,413,874 R439W probably damaging Het
Atrn A T 2: 131,023,000 probably null Het
Casd1 A G 6: 4,601,209 N14S probably damaging Het
Cry2 T C 2: 92,412,629 S542G probably benign Het
Cyb5rl A G 4: 107,068,738 Y39C probably damaging Het
Dmpk A T 7: 19,088,123 K335N probably benign Het
Dnaic1 A G 4: 41,625,221 D395G probably benign Het
Fmo4 T C 1: 162,805,188 D198G probably damaging Het
Foxc2 G A 8: 121,118,038 R475Q probably damaging Het
Gm10800 AAAGAAAACTGAA ACAAGAAAACTGAA 2: 98,667,033 probably null Het
Gm15800 T A 5: 121,339,544 N2843K possibly damaging Het
Gm2046 A T 12: 87,973,738 I71L noncoding transcript Het
Hcn4 A G 9: 58,844,150 D353G unknown Het
Hmcn1 C T 1: 150,594,010 V4973M possibly damaging Het
Il20rb C T 9: 100,459,210 S281N probably benign Het
Kcnh4 A T 11: 100,752,267 N391K possibly damaging Het
Kitl A G 10: 100,051,846 T6A probably damaging Het
Krt36 A G 11: 100,104,201 Y182H probably damaging Het
Lrp1b T G 2: 41,312,656 I1262L Het
Mtf1 A G 4: 124,844,246 E644G probably benign Het
Mtx2 A G 2: 74,869,362 Y159C probably damaging Het
Nags C T 11: 102,148,998 S504F probably damaging Het
Ncam1 A T 9: 49,545,223 F475L probably damaging Het
Nipal2 G T 15: 34,600,032 T213N possibly damaging Het
Olfr1098 A G 2: 86,922,969 S188P probably damaging Het
Pkm T C 9: 59,670,599 V233A possibly damaging Het
Pros1 T A 16: 62,928,177 I671N possibly damaging Het
Rasd1 T C 11: 59,964,292 I121V probably damaging Het
Samhd1 A G 2: 157,116,350 probably null Het
Serpinb9f A T 13: 33,325,915 Y30F probably benign Het
Slc5a10 T C 11: 61,673,281 I543V probably benign Het
Stat5a A G 11: 100,879,303 I469V possibly damaging Het
Sugct T C 13: 16,857,874 E431G probably benign Het
Tecr C A 8: 83,573,251 R133L possibly damaging Het
Tiparp A G 3: 65,531,581 N106S probably benign Het
Triml1 T C 8: 43,141,248 S49G probably benign Het
Trpm3 T A 19: 22,715,276 S244T possibly damaging Het
Ttn T C 2: 76,722,980 D31055G probably damaging Het
Vcp A T 4: 42,985,242 I369N probably damaging Het
Vmn2r110 A C 17: 20,584,429 N76K probably benign Het
Vmn2r12 T C 5: 109,086,208 T713A probably benign Het
Vmn2r17 A T 5: 109,453,369 K844N probably benign Het
Other mutations in Olfr554
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02486:Olfr554 APN 7 102640420 missense probably damaging 1.00
IGL02622:Olfr554 APN 7 102641083 missense probably damaging 1.00
R0550:Olfr554 UTSW 7 102640950 missense possibly damaging 0.84
R4051:Olfr554 UTSW 7 102641026 missense possibly damaging 0.90
R5817:Olfr554 UTSW 7 102640378 missense probably damaging 1.00
R7278:Olfr554 UTSW 7 102640983 missense probably damaging 1.00
R7427:Olfr554 UTSW 7 102640326 missense probably benign
R7428:Olfr554 UTSW 7 102640326 missense probably benign
Z1177:Olfr554 UTSW 7 102640402 missense possibly damaging 0.46
Predicted Primers PCR Primer
(F):5'- TTCAGTACCCAGCTCTTTGTGG -3'
(R):5'- ACTGTGTGAGTGAGCACCATG -3'

Sequencing Primer
(F):5'- AGCTCTTTGTGGCTCACCGG -3'
(R):5'- GCACCATGCTGTGACGC -3'
Posted On2020-07-13