Incidental Mutation 'R8234:Kitl'
ID637274
Institutional Source Beutler Lab
Gene Symbol Kitl
Ensembl Gene ENSMUSG00000019966
Gene Namekit ligand
SynonymsGb, grizzle-belly, Mgf, SCF, SF, Sl, SLF, Steel, Steel factor, stem cell factor
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.322) question?
Stock #R8234 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location100015630-100100416 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100051846 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 6 (T6A)
Ref Sequence ENSEMBL: ENSMUSP00000100920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020129] [ENSMUST00000105283] [ENSMUST00000130190]
Predicted Effect probably damaging
Transcript: ENSMUST00000020129
AA Change: T6A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966
AA Change: T6A

DomainStartEndE-ValueType
Pfam:SCF 1 176 5.7e-102 PFAM
Pfam:SCF 173 245 1.7e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105283
AA Change: T6A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966
AA Change: T6A

DomainStartEndE-ValueType
Pfam:SCF 1 273 2.3e-157 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000130190
AA Change: T46A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123360
Gene: ENSMUSG00000019966
AA Change: T46A

DomainStartEndE-ValueType
Pfam:SCF 43 160 1.1e-69 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,753,510 S1180P possibly damaging Het
Abhd4 T A 14: 54,261,676 M38K probably benign Het
Ackr1 T A 1: 173,332,015 R312S probably benign Het
Agpat9 T C 5: 100,857,210 probably null Het
Akap9 T C 5: 4,044,845 V2213A probably benign Het
Alox5 T A 6: 116,413,874 R439W probably damaging Het
Atrn A T 2: 131,023,000 probably null Het
Casd1 A G 6: 4,601,209 N14S probably damaging Het
Cry2 T C 2: 92,412,629 S542G probably benign Het
Cyb5rl A G 4: 107,068,738 Y39C probably damaging Het
Dmpk A T 7: 19,088,123 K335N probably benign Het
Dnaic1 A G 4: 41,625,221 D395G probably benign Het
Dock4 C T 12: 40,834,838 probably null Het
Fmo4 T C 1: 162,805,188 D198G probably damaging Het
Foxc2 G A 8: 121,118,038 R475Q probably damaging Het
Gipr C A 7: 19,164,608 G37V unknown Het
Gm15800 T A 5: 121,339,544 N2843K possibly damaging Het
Gm2046 A T 12: 87,973,738 I71L noncoding transcript Het
Hcn4 A G 9: 58,844,150 D353G unknown Het
Hmcn1 C T 1: 150,594,010 V4973M possibly damaging Het
Il20rb C T 9: 100,459,210 S281N probably benign Het
Kcnh4 A T 11: 100,752,267 N391K possibly damaging Het
Krt36 A G 11: 100,104,201 Y182H probably damaging Het
Lrp1b T G 2: 41,312,656 I1262L Het
Mtf1 A G 4: 124,844,246 E644G probably benign Het
Mtx2 A G 2: 74,869,362 Y159C probably damaging Het
Nags C T 11: 102,148,998 S504F probably damaging Het
Ncam1 A T 9: 49,545,223 F475L probably damaging Het
Nipal2 G T 15: 34,600,032 T213N possibly damaging Het
Olfr1098 A G 2: 86,922,969 S188P probably damaging Het
Olfr554 T A 7: 102,640,471 L75Q probably damaging Het
Pkm T C 9: 59,670,599 V233A possibly damaging Het
Pros1 T A 16: 62,928,177 I671N possibly damaging Het
Rasd1 T C 11: 59,964,292 I121V probably damaging Het
Samhd1 A G 2: 157,116,350 probably null Het
Serpinb9f A T 13: 33,325,915 Y30F probably benign Het
Slc5a10 T C 11: 61,673,281 I543V probably benign Het
Stat5a A G 11: 100,879,303 I469V possibly damaging Het
Sugct T C 13: 16,857,874 E431G probably benign Het
Tecr C A 8: 83,573,251 R133L possibly damaging Het
Tiparp A G 3: 65,531,581 N106S probably benign Het
Triml1 T C 8: 43,141,248 S49G probably benign Het
Trpm3 T A 19: 22,715,276 S244T possibly damaging Het
Ttn T C 2: 76,722,980 D31055G probably damaging Het
Vcp A T 4: 42,985,242 I369N probably damaging Het
Vmn2r110 A C 17: 20,584,429 N76K probably benign Het
Vmn2r12 T C 5: 109,086,208 T713A probably benign Het
Vmn2r17 A T 5: 109,453,369 K844N probably benign Het
Other mutations in Kitl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Kitl APN 10 100087344 splice site probably benign
IGL02066:Kitl APN 10 100076882 missense probably damaging 1.00
IGL03211:Kitl APN 10 100080859 missense probably benign 0.19
Gregory UTSW 10 100076906 critical splice donor site probably null
mooyah UTSW 10 100088222 critical splice donor site probably null
Sandycheeks UTSW 10 100076906 critical splice donor site probably null
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0131:Kitl UTSW 10 100087364 missense probably benign 0.11
R0132:Kitl UTSW 10 100087364 missense probably benign 0.11
R1554:Kitl UTSW 10 100087438 missense probably benign 0.38
R1649:Kitl UTSW 10 100064114 missense probably benign 0.03
R2194:Kitl UTSW 10 100016037 critical splice donor site probably null
R2254:Kitl UTSW 10 100080131 critical splice donor site probably null
R4877:Kitl UTSW 10 100080866 missense probably damaging 1.00
R5135:Kitl UTSW 10 100088222 critical splice donor site probably null
R5453:Kitl UTSW 10 100087385 missense probably damaging 1.00
R5564:Kitl UTSW 10 100080024 missense possibly damaging 0.89
R5832:Kitl UTSW 10 100080020 missense probably damaging 1.00
R5971:Kitl UTSW 10 100076906 critical splice donor site probably null
R6043:Kitl UTSW 10 100064085 missense probably damaging 1.00
R6067:Kitl UTSW 10 100076906 critical splice donor site probably null
R6138:Kitl UTSW 10 100076906 critical splice donor site probably null
R6255:Kitl UTSW 10 100089233 makesense probably null
R6450:Kitl UTSW 10 100087394 start codon destroyed probably null 0.00
R6588:Kitl UTSW 10 100064092 missense probably damaging 1.00
R6951:Kitl UTSW 10 100051852 missense probably damaging 1.00
R7315:Kitl UTSW 10 100016112 missense unknown
R7368:Kitl UTSW 10 100016081 missense probably benign 0.02
R8010:Kitl UTSW 10 100051903 missense probably benign 0.22
U15987:Kitl UTSW 10 100076906 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCAAACAGGACTGAAGCCAG -3'
(R):5'- GCCCTAAATCTATGTGGTCAGC -3'

Sequencing Primer
(F):5'- ACTGAAGCCAGGAGTATTTCG -3'
(R):5'- TCAGCAAGCACAGGGAAGATTC -3'
Posted On2020-07-13