Mutagenetix > Incidental Mutation

Incidental Mutation 'R8234:Kitl'

637274

Institutional Source

Beutler Lab

Gene Symbol

Kitl

Ensembl Gene

ENSMUSG00000019966

Gene Name

kit ligand

Synonyms

Gb, grizzle-belly, Mgf, SCF, SF, Sl, SLF, Steel, Steel factor, stem cell factor

MMRRC Submission

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.361) question?

Stock #

R8234 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100015630-100100416 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100051846 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 6 (T6A)

Ref Sequence

ENSEMBL: ENSMUSP00000100920 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020129] [ENSMUST00000105283] [ENSMUST00000130190]

AlphaFold

P20826

Predicted Effect

probably damaging
Transcript: ENSMUST00000020129
AA Change: T6A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000020129
Gene: ENSMUSG00000019966
AA Change: T6A

Domain	Start	End	E-Value	Type
Pfam:SCF	1	176	5.7e-102	PFAM
Pfam:SCF	173	245	1.7e-36	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000105283
AA Change: T6A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000100920
Gene: ENSMUSG00000019966
AA Change: T6A

Domain	Start	End	E-Value	Type
Pfam:SCF	1	273	2.3e-157	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000130190
AA Change: T46A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000123360
Gene: ENSMUSG00000019966
AA Change: T46A

Domain	Start	End	E-Value	Type
Pfam:SCF	43	160	1.1e-69	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the ligand of the tyrosine-kinase receptor encoded by the KIT locus. This ligand is a pleiotropic factor that acts in utero in germ cell and neural cell development, and hematopoiesis, all believed to reflect a role in cell migration. In adults, it functions pleiotropically, while mostly noted for its continued requirement in hematopoiesis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene affect migration of embryonic stem cells and cause similar phenotypes to mutations in its receptor gene (Kit). Mutants show mild to severe defects in pigmentation, hemopoiesis and reproduction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	C	1: 105,753,510	S1180P	possibly damaging	Het
Abhd4	T	A	14: 54,261,676	M38K	probably benign	Het
Ackr1	T	A	1: 173,332,015	R312S	probably benign	Het
Akap9	T	C	5: 4,044,845	V2213A	probably benign	Het
Alox5	T	A	6: 116,413,874	R439W	probably damaging	Het
Atrn	A	T	2: 131,023,000		probably null	Het
Casd1	A	G	6: 4,601,209	N14S	probably damaging	Het
Cry2	T	C	2: 92,412,629	S542G	probably benign	Het
Cyb5rl	A	G	4: 107,068,738	Y39C	probably damaging	Het
Dmpk	A	T	7: 19,088,123	K335N	probably benign	Het
Dnaic1	A	G	4: 41,625,221	D395G	probably benign	Het
Dock4	C	T	12: 40,834,838		probably null	Het
Fmo4	T	C	1: 162,805,188	D198G	probably damaging	Het
Foxc2	G	A	8: 121,118,038	R475Q	probably damaging	Het
Gipr	C	A	7: 19,164,608	G37V	unknown	Het
Gm2046	A	T	12: 87,973,738	I71L	noncoding transcript	Het
Gpat3	T	C	5: 100,857,210		probably null	Het
Hcn4	A	G	9: 58,844,150	D353G	unknown	Het
Hectd4	T	A	5: 121,339,544	N2843K	possibly damaging	Het
Hmcn1	C	T	1: 150,594,010	V4973M	possibly damaging	Het
Il20rb	C	T	9: 100,459,210	S281N	probably benign	Het
Kcnh4	A	T	11: 100,752,267	N391K	possibly damaging	Het
Krt36	A	G	11: 100,104,201	Y182H	probably damaging	Het
Lrp1b	T	G	2: 41,312,656	I1262L		Het
Mtf1	A	G	4: 124,844,246	E644G	probably benign	Het
Mtx2	A	G	2: 74,869,362	Y159C	probably damaging	Het
Nags	C	T	11: 102,148,998	S504F	probably damaging	Het
Ncam1	A	T	9: 49,545,223	F475L	probably damaging	Het
Nipal2	G	T	15: 34,600,032	T213N	possibly damaging	Het
Olfr1098	A	G	2: 86,922,969	S188P	probably damaging	Het
Olfr554	T	A	7: 102,640,471	L75Q	probably damaging	Het
Pkm	T	C	9: 59,670,599	V233A	possibly damaging	Het
Pros1	T	A	16: 62,928,177	I671N	possibly damaging	Het
Rasd1	T	C	11: 59,964,292	I121V	probably damaging	Het
Samhd1	A	G	2: 157,116,350		probably null	Het
Serpinb9f	A	T	13: 33,325,915	Y30F	probably benign	Het
Slc5a10	T	C	11: 61,673,281	I543V	probably benign	Het
Stat5a	A	G	11: 100,879,303	I469V	possibly damaging	Het
Sugct	T	C	13: 16,857,874	E431G	probably benign	Het
Tecr	C	A	8: 83,573,251	R133L	possibly damaging	Het
Tiparp	A	G	3: 65,531,581	N106S	probably benign	Het
Triml1	T	C	8: 43,141,248	S49G	probably benign	Het
Trpm3	T	A	19: 22,715,276	S244T	possibly damaging	Het
Ttn	T	C	2: 76,722,980	D31055G	probably damaging	Het
Vcp	A	T	4: 42,985,242	I369N	probably damaging	Het
Vmn2r110	A	C	17: 20,584,429	N76K	probably benign	Het
Vmn2r12	T	C	5: 109,086,208	T713A	probably benign	Het
Vmn2r17	A	T	5: 109,453,369	K844N	probably benign	Het

Other mutations in Kitl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00823:Kitl	APN	10	100087344	splice site	probably benign
IGL02066:Kitl	APN	10	100076882	missense	probably damaging	1.00
IGL03211:Kitl	APN	10	100080859	missense	probably benign	0.19
Gregory	UTSW	10	100076906	critical splice donor site	probably null
mooyah	UTSW	10	100088222	critical splice donor site	probably null
Sandycheeks	UTSW	10	100076906	critical splice donor site	probably null
R0131:Kitl	UTSW	10	100087364	missense	probably benign	0.11
R0131:Kitl	UTSW	10	100087364	missense	probably benign	0.11
R0132:Kitl	UTSW	10	100087364	missense	probably benign	0.11
R1554:Kitl	UTSW	10	100087438	missense	probably benign	0.38
R1649:Kitl	UTSW	10	100064114	missense	probably benign	0.03
R2194:Kitl	UTSW	10	100016037	critical splice donor site	probably null
R2254:Kitl	UTSW	10	100080131	critical splice donor site	probably null
R4877:Kitl	UTSW	10	100080866	missense	probably damaging	1.00
R5135:Kitl	UTSW	10	100088222	critical splice donor site	probably null
R5453:Kitl	UTSW	10	100087385	missense	probably damaging	1.00
R5564:Kitl	UTSW	10	100080024	missense	possibly damaging	0.89
R5832:Kitl	UTSW	10	100080020	missense	probably damaging	1.00
R5971:Kitl	UTSW	10	100076906	critical splice donor site	probably null
R6043:Kitl	UTSW	10	100064085	missense	probably damaging	1.00
R6067:Kitl	UTSW	10	100076906	critical splice donor site	probably null
R6138:Kitl	UTSW	10	100076906	critical splice donor site	probably null
R6255:Kitl	UTSW	10	100089233	makesense	probably null
R6450:Kitl	UTSW	10	100087394	start codon destroyed	probably null	0.00
R6588:Kitl	UTSW	10	100064092	missense	probably damaging	1.00
R6951:Kitl	UTSW	10	100051852	missense	probably damaging	1.00
R7315:Kitl	UTSW	10	100016112	missense	unknown
R7368:Kitl	UTSW	10	100016081	missense	probably benign	0.02
R8010:Kitl	UTSW	10	100051903	missense	probably benign	0.22
R9613:Kitl	UTSW	10	100080919	missense	probably damaging	1.00
U15987:Kitl	UTSW	10	100076906	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCAAACAGGACTGAAGCCAG -3'
(R):5'- GCCCTAAATCTATGTGGTCAGC -3'

Sequencing Primer
(F):5'- ACTGAAGCCAGGAGTATTTCG -3'
(R):5'- TCAGCAAGCACAGGGAAGATTC -3'

Posted On

2020-07-13