Incidental Mutation 'R8234:Rasd1'
ID637275
Institutional Source Beutler Lab
Gene Symbol Rasd1
Ensembl Gene ENSMUSG00000049892
Gene NameRAS, dexamethasone-induced 1
SynonymsDexras1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8234 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location59963181-59964944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59964292 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 121 (I121V)
Ref Sequence ENSEMBL: ENSMUSP00000051959 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062405] [ENSMUST00000081980]
Predicted Effect probably damaging
Transcript: ENSMUST00000062405
AA Change: I121V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051959
Gene: ENSMUSG00000049892
AA Change: I121V

DomainStartEndE-ValueType
RAS 22 198 4.81e-81 SMART
low complexity region 217 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000081980
SMART Domains Protein: ENSMUSP00000080641
Gene: ENSMUSG00000061650

DomainStartEndE-ValueType
low complexity region 16 52 N/A INTRINSIC
Pfam:Med9 59 135 3.2e-27 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: This gene encodes a member of the Ras superfamily of small GTPases and is induced by dexamethasone. The encoded protein is an activator of G-protein signaling and acts as a direct nucleotide exchange factor for Gi-Go proteins. This gene may play a role in dexamethasone-induced alterations in cell morphology, growth and cell-extracellular matrix interactions. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene have a reduced ability to entrain to low intensity light with resulting abnormalities in circadian rhythm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,753,510 S1180P possibly damaging Het
Abhd4 T A 14: 54,261,676 M38K probably benign Het
Ackr1 T A 1: 173,332,015 R312S probably benign Het
Agpat9 T C 5: 100,857,210 probably null Het
Akap9 T C 5: 4,044,845 V2213A probably benign Het
Alox5 T A 6: 116,413,874 R439W probably damaging Het
Atrn A T 2: 131,023,000 probably null Het
Casd1 A G 6: 4,601,209 N14S probably damaging Het
Cry2 T C 2: 92,412,629 S542G probably benign Het
Cyb5rl A G 4: 107,068,738 Y39C probably damaging Het
Dmpk A T 7: 19,088,123 K335N probably benign Het
Dnaic1 A G 4: 41,625,221 D395G probably benign Het
Dock4 C T 12: 40,834,838 probably null Het
Fmo4 T C 1: 162,805,188 D198G probably damaging Het
Foxc2 G A 8: 121,118,038 R475Q probably damaging Het
Gipr C A 7: 19,164,608 G37V unknown Het
Gm15800 T A 5: 121,339,544 N2843K possibly damaging Het
Gm2046 A T 12: 87,973,738 I71L noncoding transcript Het
Hcn4 A G 9: 58,844,150 D353G unknown Het
Hmcn1 C T 1: 150,594,010 V4973M possibly damaging Het
Il20rb C T 9: 100,459,210 S281N probably benign Het
Kcnh4 A T 11: 100,752,267 N391K possibly damaging Het
Kitl A G 10: 100,051,846 T6A probably damaging Het
Krt36 A G 11: 100,104,201 Y182H probably damaging Het
Lrp1b T G 2: 41,312,656 I1262L Het
Mtf1 A G 4: 124,844,246 E644G probably benign Het
Mtx2 A G 2: 74,869,362 Y159C probably damaging Het
Nags C T 11: 102,148,998 S504F probably damaging Het
Ncam1 A T 9: 49,545,223 F475L probably damaging Het
Nipal2 G T 15: 34,600,032 T213N possibly damaging Het
Olfr1098 A G 2: 86,922,969 S188P probably damaging Het
Olfr554 T A 7: 102,640,471 L75Q probably damaging Het
Pkm T C 9: 59,670,599 V233A possibly damaging Het
Pros1 T A 16: 62,928,177 I671N possibly damaging Het
Samhd1 A G 2: 157,116,350 probably null Het
Serpinb9f A T 13: 33,325,915 Y30F probably benign Het
Slc5a10 T C 11: 61,673,281 I543V probably benign Het
Stat5a A G 11: 100,879,303 I469V possibly damaging Het
Sugct T C 13: 16,857,874 E431G probably benign Het
Tecr C A 8: 83,573,251 R133L possibly damaging Het
Tiparp A G 3: 65,531,581 N106S probably benign Het
Triml1 T C 8: 43,141,248 S49G probably benign Het
Trpm3 T A 19: 22,715,276 S244T possibly damaging Het
Ttn T C 2: 76,722,980 D31055G probably damaging Het
Vcp A T 4: 42,985,242 I369N probably damaging Het
Vmn2r110 A C 17: 20,584,429 N76K probably benign Het
Vmn2r12 T C 5: 109,086,208 T713A probably benign Het
Vmn2r17 A T 5: 109,453,369 K844N probably benign Het
Other mutations in Rasd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Rasd1 APN 11 59964291 missense probably damaging 1.00
IGL02206:Rasd1 APN 11 59963952 missense possibly damaging 0.69
IGL02534:Rasd1 APN 11 59964789 missense possibly damaging 0.86
IGL03306:Rasd1 APN 11 59964355 missense possibly damaging 0.64
R0833:Rasd1 UTSW 11 59964553 missense probably damaging 1.00
R0836:Rasd1 UTSW 11 59964553 missense probably damaging 1.00
R1160:Rasd1 UTSW 11 59964721 missense possibly damaging 0.78
R1647:Rasd1 UTSW 11 59964094 missense probably benign 0.26
R5114:Rasd1 UTSW 11 59964107 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- GAGATCTCGAAGTAGGCACAAC -3'
(R):5'- ATCCGGCAATCATCCGTTTC -3'

Sequencing Primer
(F):5'- TAGGCACAACGCTGAGGGTC -3'
(R):5'- ACCGGAGTCTTGAGGGG -3'
Posted On2020-07-13