Mutagenetix > Incidental Mutation

Incidental Mutation 'R8234:Stat5a'

637279

Institutional Source

Beutler Lab

Gene Symbol

Stat5a

Ensembl Gene

ENSMUSG00000004043

Gene Name

signal transducer and activator of transcription 5A

Synonyms

STAT5

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8234 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

100859351-100885169 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 100879303 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 469 (I469V)

Ref Sequence

ENSEMBL: ENSMUSP00000102980 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004145] [ENSMUST00000107356] [ENSMUST00000107357]

AlphaFold

P42230

Predicted Effect

probably benign
Transcript: ENSMUST00000004145
AA Change: I469V

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000004145
Gene: ENSMUSG00000004043
AA Change: I469V

Domain	Start	End	E-Value	Type
STAT_int	2	126	4.42e-62	SMART
Pfam:STAT_alpha	138	330	6.9e-58	PFAM
Pfam:STAT_bind	332	583	2.4e-101	PFAM
SH2	587	688	7.64e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107356
AA Change: I469V

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000102979
Gene: ENSMUSG00000004043
AA Change: I469V

Domain	Start	End	E-Value	Type
STAT_int	2	126	4.42e-62	SMART
Pfam:STAT_alpha	138	330	6.9e-58	PFAM
Pfam:STAT_bind	332	583	2.4e-101	PFAM
SH2	587	688	7.64e-6	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107357
AA Change: I469V

PolyPhen 2 Score 0.591 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000102980
Gene: ENSMUSG00000004043
AA Change: I469V

Domain	Start	End	E-Value	Type
STAT_int	2	126	4.42e-62	SMART
Pfam:STAT_alpha	141	330	4.5e-57	PFAM
Pfam:STAT_bind	332	582	1e-104	PFAM
SH2	587	688	1.55e-6	SMART
low complexity region	713	729	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. This protein is activated by, and mediates the responses of many cell ligands, such as IL2, IL3, IL7 GM-CSF, erythropoietin, thrombopoietin, and different growth hormones. Activation of this protein in myeloma and lymphoma associated with a TEL/JAK2 gene fusion is independent of cell stimulus and has been shown to be essential for tumorigenesis. The mouse counterpart of this gene is found to induce the expression of BCL2L1/BCL-X(L), which suggests the antiapoptotic function of this gene in cells. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Dec 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene are reduced in size and display abnormalities in both mammary gland structure and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	C	1: 105,753,510	S1180P	possibly damaging	Het
Abhd4	T	A	14: 54,261,676	M38K	probably benign	Het
Ackr1	T	A	1: 173,332,015	R312S	probably benign	Het
Agpat9	T	C	5: 100,857,210		probably null	Het
Akap9	T	C	5: 4,044,845	V2213A	probably benign	Het
Alox5	T	A	6: 116,413,874	R439W	probably damaging	Het
Atrn	A	T	2: 131,023,000		probably null	Het
Casd1	A	G	6: 4,601,209	N14S	probably damaging	Het
Cry2	T	C	2: 92,412,629	S542G	probably benign	Het
Cyb5rl	A	G	4: 107,068,738	Y39C	probably damaging	Het
Dmpk	A	T	7: 19,088,123	K335N	probably benign	Het
Dnaic1	A	G	4: 41,625,221	D395G	probably benign	Het
Dock4	C	T	12: 40,834,838		probably null	Het
Fmo4	T	C	1: 162,805,188	D198G	probably damaging	Het
Foxc2	G	A	8: 121,118,038	R475Q	probably damaging	Het
Gipr	C	A	7: 19,164,608	G37V	unknown	Het
Gm15800	T	A	5: 121,339,544	N2843K	possibly damaging	Het
Gm2046	A	T	12: 87,973,738	I71L	noncoding transcript	Het
Hcn4	A	G	9: 58,844,150	D353G	unknown	Het
Hmcn1	C	T	1: 150,594,010	V4973M	possibly damaging	Het
Il20rb	C	T	9: 100,459,210	S281N	probably benign	Het
Kcnh4	A	T	11: 100,752,267	N391K	possibly damaging	Het
Kitl	A	G	10: 100,051,846	T6A	probably damaging	Het
Krt36	A	G	11: 100,104,201	Y182H	probably damaging	Het
Lrp1b	T	G	2: 41,312,656	I1262L		Het
Mtf1	A	G	4: 124,844,246	E644G	probably benign	Het
Mtx2	A	G	2: 74,869,362	Y159C	probably damaging	Het
Nags	C	T	11: 102,148,998	S504F	probably damaging	Het
Ncam1	A	T	9: 49,545,223	F475L	probably damaging	Het
Nipal2	G	T	15: 34,600,032	T213N	possibly damaging	Het
Olfr1098	A	G	2: 86,922,969	S188P	probably damaging	Het
Olfr554	T	A	7: 102,640,471	L75Q	probably damaging	Het
Pkm	T	C	9: 59,670,599	V233A	possibly damaging	Het
Pros1	T	A	16: 62,928,177	I671N	possibly damaging	Het
Rasd1	T	C	11: 59,964,292	I121V	probably damaging	Het
Samhd1	A	G	2: 157,116,350		probably null	Het
Serpinb9f	A	T	13: 33,325,915	Y30F	probably benign	Het
Slc5a10	T	C	11: 61,673,281	I543V	probably benign	Het
Sugct	T	C	13: 16,857,874	E431G	probably benign	Het
Tecr	C	A	8: 83,573,251	R133L	possibly damaging	Het
Tiparp	A	G	3: 65,531,581	N106S	probably benign	Het
Triml1	T	C	8: 43,141,248	S49G	probably benign	Het
Trpm3	T	A	19: 22,715,276	S244T	possibly damaging	Het
Ttn	T	C	2: 76,722,980	D31055G	probably damaging	Het
Vcp	A	T	4: 42,985,242	I369N	probably damaging	Het
Vmn2r110	A	C	17: 20,584,429	N76K	probably benign	Het
Vmn2r12	T	C	5: 109,086,208	T713A	probably benign	Het
Vmn2r17	A	T	5: 109,453,369	K844N	probably benign	Het

Other mutations in Stat5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01352:Stat5a	APN	11	100881072	missense	probably damaging	1.00
IGL02021:Stat5a	APN	11	100883889	missense	probably damaging	1.00
IGL02032:Stat5a	APN	11	100861828	missense	probably damaging	0.99
IGL03108:Stat5a	APN	11	100863139	nonsense	probably null
IGL03160:Stat5a	APN	11	100861845	missense	possibly damaging	0.71
Blinken	UTSW	11	100880482	missense
hohum	UTSW	11	100874129	missense	probably damaging	1.00
Nod	UTSW	11	100876863	missense	probably damaging	1.00
Nodoze	UTSW	11	100880527	missense	probably benign	0.05
Yawn	UTSW	11	100879693	missense	possibly damaging	0.50
R0098:Stat5a	UTSW	11	100875626	missense	probably damaging	0.98
R0362:Stat5a	UTSW	11	100882083	missense	probably benign	0.01
R0452:Stat5a	UTSW	11	100863135	missense	probably benign	0.20
R0520:Stat5a	UTSW	11	100861426	missense	probably damaging	0.98
R0815:Stat5a	UTSW	11	100875082	splice site	probably null
R1081:Stat5a	UTSW	11	100881060	missense	probably damaging	1.00
R1752:Stat5a	UTSW	11	100884058	makesense	probably null
R1774:Stat5a	UTSW	11	100879286	missense	probably damaging	1.00
R1868:Stat5a	UTSW	11	100874129	missense	probably damaging	1.00
R2152:Stat5a	UTSW	11	100874090	missense	probably benign	0.38
R2900:Stat5a	UTSW	11	100874131	missense	probably benign	0.18
R4023:Stat5a	UTSW	11	100874926	nonsense	probably null
R4791:Stat5a	UTSW	11	100865463	missense	probably damaging	1.00
R5396:Stat5a	UTSW	11	100880583	missense	probably damaging	1.00
R5641:Stat5a	UTSW	11	100876808	missense	probably benign	0.01
R5723:Stat5a	UTSW	11	100882074	missense	probably benign	0.00
R5896:Stat5a	UTSW	11	100877057	missense	possibly damaging	0.94
R6026:Stat5a	UTSW	11	100880316	missense	probably damaging	1.00
R7052:Stat5a	UTSW	11	100879285	missense	probably damaging	1.00
R7075:Stat5a	UTSW	11	100879693	missense	possibly damaging	0.50
R7568:Stat5a	UTSW	11	100875024	missense	possibly damaging	0.74
R7771:Stat5a	UTSW	11	100863219	missense	probably benign	0.34
R7801:Stat5a	UTSW	11	100880317	missense	probably damaging	1.00
R7814:Stat5a	UTSW	11	100875027	missense	probably damaging	1.00
R7856:Stat5a	UTSW	11	100883902	missense	unknown
R8176:Stat5a	UTSW	11	100876863	missense	probably damaging	1.00
R8680:Stat5a	UTSW	11	100883888	missense	unknown
R8923:Stat5a	UTSW	11	100880482	missense
R8970:Stat5a	UTSW	11	100880527	missense	probably benign	0.05
R8988:Stat5a	UTSW	11	100883938	missense	unknown
R9401:Stat5a	UTSW	11	100865428	missense	possibly damaging	0.73
R9433:Stat5a	UTSW	11	100875044	missense	probably benign	0.03
R9526:Stat5a	UTSW	11	100880335	missense

Predicted Primers

PCR Primer
(F):5'- CACTGGGACACTAAGCATAAGC -3'
(R):5'- TTAGGACCTGCCAGCCAATG -3'

Sequencing Primer
(F):5'- AAGCCTCGCACACGCTG -3'
(R):5'- GCCTAACCTGAGGACAAT -3'

Posted On

2020-07-13