Mutagenetix > Incidental Mutation

Incidental Mutation 'R8234:Nags'

637280

Institutional Source

Beutler Lab

Gene Symbol

Nags

Ensembl Gene

ENSMUSG00000048217

Gene Name

N-acetylglutamate synthase

Synonyms

1700120E20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.737) question?

Stock #

R8234 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

102145513-102149477 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 102148998 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Phenylalanine at position 504 (S504F)

Ref Sequence

ENSEMBL: ENSMUSP00000050258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021296] [ENSMUST00000055409]

AlphaFold

Q8R4H7

Predicted Effect

probably benign
Transcript: ENSMUST00000021296

SMART Domains

Protein: ENSMUSP00000021296
Gene: ENSMUSG00000020921

Domain	Start	End	E-Value	Type
Pfam:TMEM101	8	256	9.9e-122	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000055409
AA Change: S504F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000050258
Gene: ENSMUSG00000048217
AA Change: S504F

Domain	Start	End	E-Value	Type
low complexity region	9	48	N/A	INTRINSIC
low complexity region	77	90	N/A	INTRINSIC
Pfam:NAT	349	514	3.5e-50	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-acetylglutamate synthase gene encodes a mitochondrial enzyme that catalyzes the formation of N-acetylglutamate (NAG) from glutamate and acetyl coenzyme-A. NAG is a cofactor of carbamyl phosphate synthetase I (CPSI), the first enzyme of the urea cycle in mammals. This gene may regulate ureagenesis by altering NAG availability and, thereby, CPSI activity. Deficiencies in N-acetylglutamate synthase have been associated with hyperammonemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: In the absence of N-carbamyl-L-glutamate and L-citrulline supplementation homozygous null mice develop severe hyperammonemia and die. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	C	1: 105,753,510	S1180P	possibly damaging	Het
Abhd4	T	A	14: 54,261,676	M38K	probably benign	Het
Ackr1	T	A	1: 173,332,015	R312S	probably benign	Het
Agpat9	T	C	5: 100,857,210		probably null	Het
Akap9	T	C	5: 4,044,845	V2213A	probably benign	Het
Alox5	T	A	6: 116,413,874	R439W	probably damaging	Het
Atrn	A	T	2: 131,023,000		probably null	Het
Casd1	A	G	6: 4,601,209	N14S	probably damaging	Het
Cry2	T	C	2: 92,412,629	S542G	probably benign	Het
Cyb5rl	A	G	4: 107,068,738	Y39C	probably damaging	Het
Dmpk	A	T	7: 19,088,123	K335N	probably benign	Het
Dnaic1	A	G	4: 41,625,221	D395G	probably benign	Het
Dock4	C	T	12: 40,834,838		probably null	Het
Fmo4	T	C	1: 162,805,188	D198G	probably damaging	Het
Foxc2	G	A	8: 121,118,038	R475Q	probably damaging	Het
Gipr	C	A	7: 19,164,608	G37V	unknown	Het
Gm15800	T	A	5: 121,339,544	N2843K	possibly damaging	Het
Gm2046	A	T	12: 87,973,738	I71L	noncoding transcript	Het
Hcn4	A	G	9: 58,844,150	D353G	unknown	Het
Hmcn1	C	T	1: 150,594,010	V4973M	possibly damaging	Het
Il20rb	C	T	9: 100,459,210	S281N	probably benign	Het
Kcnh4	A	T	11: 100,752,267	N391K	possibly damaging	Het
Kitl	A	G	10: 100,051,846	T6A	probably damaging	Het
Krt36	A	G	11: 100,104,201	Y182H	probably damaging	Het
Lrp1b	T	G	2: 41,312,656	I1262L		Het
Mtf1	A	G	4: 124,844,246	E644G	probably benign	Het
Mtx2	A	G	2: 74,869,362	Y159C	probably damaging	Het
Ncam1	A	T	9: 49,545,223	F475L	probably damaging	Het
Nipal2	G	T	15: 34,600,032	T213N	possibly damaging	Het
Olfr1098	A	G	2: 86,922,969	S188P	probably damaging	Het
Olfr554	T	A	7: 102,640,471	L75Q	probably damaging	Het
Pkm	T	C	9: 59,670,599	V233A	possibly damaging	Het
Pros1	T	A	16: 62,928,177	I671N	possibly damaging	Het
Rasd1	T	C	11: 59,964,292	I121V	probably damaging	Het
Samhd1	A	G	2: 157,116,350		probably null	Het
Serpinb9f	A	T	13: 33,325,915	Y30F	probably benign	Het
Slc5a10	T	C	11: 61,673,281	I543V	probably benign	Het
Stat5a	A	G	11: 100,879,303	I469V	possibly damaging	Het
Sugct	T	C	13: 16,857,874	E431G	probably benign	Het
Tecr	C	A	8: 83,573,251	R133L	possibly damaging	Het
Tiparp	A	G	3: 65,531,581	N106S	probably benign	Het
Triml1	T	C	8: 43,141,248	S49G	probably benign	Het
Trpm3	T	A	19: 22,715,276	S244T	possibly damaging	Het
Ttn	T	C	2: 76,722,980	D31055G	probably damaging	Het
Vcp	A	T	4: 42,985,242	I369N	probably damaging	Het
Vmn2r110	A	C	17: 20,584,429	N76K	probably benign	Het
Vmn2r12	T	C	5: 109,086,208	T713A	probably benign	Het
Vmn2r17	A	T	5: 109,453,369	K844N	probably benign	Het

Other mutations in Nags

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Nags	APN	11	102149066	missense	probably damaging	1.00
IGL02308:Nags	APN	11	102149071	makesense	probably null
IGL02551:Nags	APN	11	102147941	missense	probably damaging	1.00
IGL03114:Nags	APN	11	102148988	missense	probably damaging	1.00
R0254:Nags	UTSW	11	102147945	missense	probably damaging	1.00
R0395:Nags	UTSW	11	102145704	missense	unknown
R0573:Nags	UTSW	11	102146979	missense	probably damaging	0.97
R3085:Nags	UTSW	11	102145984	missense	probably damaging	1.00
R4687:Nags	UTSW	11	102148196	missense	probably damaging	0.97
R4852:Nags	UTSW	11	102146621	nonsense	probably null
R5093:Nags	UTSW	11	102146569	missense	probably damaging	1.00
R5516:Nags	UTSW	11	102145947	nonsense	probably null
R6374:Nags	UTSW	11	102146511	missense	possibly damaging	0.58
R6713:Nags	UTSW	11	102146521	missense	probably benign	0.27
R6741:Nags	UTSW	11	102146892	missense	possibly damaging	0.88
R7082:Nags	UTSW	11	102147472	missense	possibly damaging	0.90
R7903:Nags	UTSW	11	102146677	missense	possibly damaging	0.61
R9072:Nags	UTSW	11	102147521	missense	probably damaging	1.00
R9073:Nags	UTSW	11	102147521	missense	probably damaging	1.00
R9090:Nags	UTSW	11	102146758	missense	probably benign	0.25
R9271:Nags	UTSW	11	102146758	missense	probably benign	0.25
R9546:Nags	UTSW	11	102148255	missense	probably damaging	0.97
X0017:Nags	UTSW	11	102145747	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TCCTGCTAAGATAAAAGAACAGGC -3'
(R):5'- CAGACGATGCTGCTATGCTG -3'

Sequencing Primer
(F):5'- AACAGGCATCTGGTCCTGGTG -3'
(R):5'- GCTGCAGCTTCTTCCCC -3'

Posted On

2020-07-13