Incidental Mutation 'R8234:Serpinb9f'
ID637283
Institutional Source Beutler Lab
Gene Symbol Serpinb9f
Ensembl Gene ENSMUSG00000038327
Gene Nameserine (or cysteine) peptidase inhibitor, clade B, member 9f
SynonymsNK21, ovalbumin, Spi13
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R8234 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location33324077-33335370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 33325915 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 30 (Y30F)
Ref Sequence ENSEMBL: ENSMUSP00000074958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075515]
Predicted Effect probably benign
Transcript: ENSMUST00000075515
AA Change: Y30F

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074958
Gene: ENSMUSG00000038327
AA Change: Y30F

DomainStartEndE-ValueType
SERPIN 13 377 2.03e-166 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,753,510 S1180P possibly damaging Het
Abhd4 T A 14: 54,261,676 M38K probably benign Het
Ackr1 T A 1: 173,332,015 R312S probably benign Het
Agpat9 T C 5: 100,857,210 probably null Het
Akap9 T C 5: 4,044,845 V2213A probably benign Het
Alox5 T A 6: 116,413,874 R439W probably damaging Het
Atrn A T 2: 131,023,000 probably null Het
Casd1 A G 6: 4,601,209 N14S probably damaging Het
Cry2 T C 2: 92,412,629 S542G probably benign Het
Cyb5rl A G 4: 107,068,738 Y39C probably damaging Het
Dmpk A T 7: 19,088,123 K335N probably benign Het
Dnaic1 A G 4: 41,625,221 D395G probably benign Het
Dock4 C T 12: 40,834,838 probably null Het
Fmo4 T C 1: 162,805,188 D198G probably damaging Het
Foxc2 G A 8: 121,118,038 R475Q probably damaging Het
Gipr C A 7: 19,164,608 G37V unknown Het
Gm15800 T A 5: 121,339,544 N2843K possibly damaging Het
Gm2046 A T 12: 87,973,738 I71L noncoding transcript Het
Hcn4 A G 9: 58,844,150 D353G unknown Het
Hmcn1 C T 1: 150,594,010 V4973M possibly damaging Het
Il20rb C T 9: 100,459,210 S281N probably benign Het
Kcnh4 A T 11: 100,752,267 N391K possibly damaging Het
Kitl A G 10: 100,051,846 T6A probably damaging Het
Krt36 A G 11: 100,104,201 Y182H probably damaging Het
Lrp1b T G 2: 41,312,656 I1262L Het
Mtf1 A G 4: 124,844,246 E644G probably benign Het
Mtx2 A G 2: 74,869,362 Y159C probably damaging Het
Nags C T 11: 102,148,998 S504F probably damaging Het
Ncam1 A T 9: 49,545,223 F475L probably damaging Het
Nipal2 G T 15: 34,600,032 T213N possibly damaging Het
Olfr1098 A G 2: 86,922,969 S188P probably damaging Het
Olfr554 T A 7: 102,640,471 L75Q probably damaging Het
Pkm T C 9: 59,670,599 V233A possibly damaging Het
Pros1 T A 16: 62,928,177 I671N possibly damaging Het
Rasd1 T C 11: 59,964,292 I121V probably damaging Het
Samhd1 A G 2: 157,116,350 probably null Het
Slc5a10 T C 11: 61,673,281 I543V probably benign Het
Stat5a A G 11: 100,879,303 I469V possibly damaging Het
Sugct T C 13: 16,857,874 E431G probably benign Het
Tecr C A 8: 83,573,251 R133L possibly damaging Het
Tiparp A G 3: 65,531,581 N106S probably benign Het
Triml1 T C 8: 43,141,248 S49G probably benign Het
Trpm3 T A 19: 22,715,276 S244T possibly damaging Het
Ttn T C 2: 76,722,980 D31055G probably damaging Het
Vcp A T 4: 42,985,242 I369N probably damaging Het
Vmn2r110 A C 17: 20,584,429 N76K probably benign Het
Vmn2r12 T C 5: 109,086,208 T713A probably benign Het
Vmn2r17 A T 5: 109,453,369 K844N probably benign Het
Other mutations in Serpinb9f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02113:Serpinb9f APN 13 33334468 missense probably damaging 1.00
IGL03272:Serpinb9f APN 13 33327916 missense probably damaging 1.00
R0112:Serpinb9f UTSW 13 33327951 splice site probably benign
R0254:Serpinb9f UTSW 13 33334591 missense probably damaging 1.00
R0498:Serpinb9f UTSW 13 33326007 splice site probably benign
R0711:Serpinb9f UTSW 13 33327921 missense probably damaging 1.00
R1004:Serpinb9f UTSW 13 33334242 critical splice acceptor site probably benign
R1913:Serpinb9f UTSW 13 33325846 missense probably damaging 1.00
R2214:Serpinb9f UTSW 13 33334609 missense probably benign 0.00
R3908:Serpinb9f UTSW 13 33327936 missense probably damaging 0.99
R6182:Serpinb9f UTSW 13 33334422 missense probably damaging 1.00
R6421:Serpinb9f UTSW 13 33334533 missense probably benign 0.01
R6965:Serpinb9f UTSW 13 33325876 missense possibly damaging 0.50
R7043:Serpinb9f UTSW 13 33325987 missense possibly damaging 0.85
R7406:Serpinb9f UTSW 13 33334560 nonsense probably null
R8182:Serpinb9f UTSW 13 33334620 missense probably benign 0.03
R8341:Serpinb9f UTSW 13 33327307 nonsense probably null
R8492:Serpinb9f UTSW 13 33334604 missense probably damaging 1.00
R8794:Serpinb9f UTSW 13 33329413 missense probably benign 0.15
X0019:Serpinb9f UTSW 13 33334534 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGAGTTCCGTATTTCCCTTCATCAG -3'
(R):5'- CCAGCTTCAAAGAGGCTTTTGG -3'

Sequencing Primer
(F):5'- CGTATTTCCCTTCATCAGAACAATG -3'
(R):5'- TAGCACAACCAGGGTCAATTTTAC -3'
Posted On2020-07-13