Mutagenetix > Incidental Mutation

Incidental Mutation 'R8234:Pros1'

637286

Institutional Source

Beutler Lab

Gene Symbol

Pros1

Ensembl Gene

ENSMUSG00000022912

Gene Name

protein S (alpha)

Synonyms

protein S

MMRRC Submission

Accession Numbers

Genbank: NM_011173; MGI: 1095733

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R8234 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

62854307-62929346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 62928177 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 671 (I671N)

Ref Sequence

ENSEMBL: ENSMUSP00000023629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023629]

AlphaFold

Q08761

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023629
AA Change: I671N

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000023629
Gene: ENSMUSG00000022912
AA Change: I671N

Domain	Start	End	E-Value	Type
GLA	23	86	3.63e-31	SMART
EGF	120	155	4.39e-2	SMART
EGF_CA	157	200	6.91e-9	SMART
EGF_CA	201	242	5.23e-9	SMART
EGF_CA	243	283	1.1e-7	SMART
LamG	321	458	8.55e-22	SMART
LamG	506	646	1.57e-1	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.8%

Validation Efficiency

100% (49/49)

MGI Phenotype

FUNCTION: This gene encodes a vitamin K-dependent protein with key roles in multiple biological processes including coagulation, apoptosis and vasculogenesis. The encoded protein undergoes proteolytic processing to generate a mature protein which is secreted into the plasma. Mice lacking the encoded protein die in utero from a fulminant coagulopathy and associated hemorrhages. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality associated with thrombosis, hemorrhage, and thrombocytopenia. [provided by MGI curators]

Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Targeted, other(2) Gene trapped(2)

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	C	1: 105,753,510	S1180P	possibly damaging	Het
Abhd4	T	A	14: 54,261,676	M38K	probably benign	Het
Ackr1	T	A	1: 173,332,015	R312S	probably benign	Het
Agpat9	T	C	5: 100,857,210		probably null	Het
Akap9	T	C	5: 4,044,845	V2213A	probably benign	Het
Alox5	T	A	6: 116,413,874	R439W	probably damaging	Het
Atrn	A	T	2: 131,023,000		probably null	Het
Casd1	A	G	6: 4,601,209	N14S	probably damaging	Het
Cry2	T	C	2: 92,412,629	S542G	probably benign	Het
Cyb5rl	A	G	4: 107,068,738	Y39C	probably damaging	Het
Dmpk	A	T	7: 19,088,123	K335N	probably benign	Het
Dnaic1	A	G	4: 41,625,221	D395G	probably benign	Het
Dock4	C	T	12: 40,834,838		probably null	Het
Fmo4	T	C	1: 162,805,188	D198G	probably damaging	Het
Foxc2	G	A	8: 121,118,038	R475Q	probably damaging	Het
Gipr	C	A	7: 19,164,608	G37V	unknown	Het
Gm15800	T	A	5: 121,339,544	N2843K	possibly damaging	Het
Gm2046	A	T	12: 87,973,738	I71L	noncoding transcript	Het
Hcn4	A	G	9: 58,844,150	D353G	unknown	Het
Hmcn1	C	T	1: 150,594,010	V4973M	possibly damaging	Het
Il20rb	C	T	9: 100,459,210	S281N	probably benign	Het
Kcnh4	A	T	11: 100,752,267	N391K	possibly damaging	Het
Kitl	A	G	10: 100,051,846	T6A	probably damaging	Het
Krt36	A	G	11: 100,104,201	Y182H	probably damaging	Het
Lrp1b	T	G	2: 41,312,656	I1262L		Het
Mtf1	A	G	4: 124,844,246	E644G	probably benign	Het
Mtx2	A	G	2: 74,869,362	Y159C	probably damaging	Het
Nags	C	T	11: 102,148,998	S504F	probably damaging	Het
Ncam1	A	T	9: 49,545,223	F475L	probably damaging	Het
Nipal2	G	T	15: 34,600,032	T213N	possibly damaging	Het
Olfr1098	A	G	2: 86,922,969	S188P	probably damaging	Het
Olfr554	T	A	7: 102,640,471	L75Q	probably damaging	Het
Pkm	T	C	9: 59,670,599	V233A	possibly damaging	Het
Rasd1	T	C	11: 59,964,292	I121V	probably damaging	Het
Samhd1	A	G	2: 157,116,350		probably null	Het
Serpinb9f	A	T	13: 33,325,915	Y30F	probably benign	Het
Slc5a10	T	C	11: 61,673,281	I543V	probably benign	Het
Stat5a	A	G	11: 100,879,303	I469V	possibly damaging	Het
Sugct	T	C	13: 16,857,874	E431G	probably benign	Het
Tecr	C	A	8: 83,573,251	R133L	possibly damaging	Het
Tiparp	A	G	3: 65,531,581	N106S	probably benign	Het
Triml1	T	C	8: 43,141,248	S49G	probably benign	Het
Trpm3	T	A	19: 22,715,276	S244T	possibly damaging	Het
Ttn	T	C	2: 76,722,980	D31055G	probably damaging	Het
Vcp	A	T	4: 42,985,242	I369N	probably damaging	Het
Vmn2r110	A	C	17: 20,584,429	N76K	probably benign	Het
Vmn2r12	T	C	5: 109,086,208	T713A	probably benign	Het
Vmn2r17	A	T	5: 109,453,369	K844N	probably benign	Het

Other mutations in Pros1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00937:Pros1	APN	16	62910045	missense	probably damaging	0.99
IGL01300:Pros1	APN	16	62913811	missense	possibly damaging	0.85
IGL02709:Pros1	APN	16	62898945	missense	probably damaging	0.99
IGL03080:Pros1	APN	16	62918143	missense	probably damaging	0.98
IGL03095:Pros1	APN	16	62907769	nonsense	probably null
F6893:Pros1	UTSW	16	62924639	missense	probably damaging	0.98
R0124:Pros1	UTSW	16	62913946	missense	possibly damaging	0.95
R0517:Pros1	UTSW	16	62903518	missense	probably benign	0.03
R1113:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1308:Pros1	UTSW	16	62913865	missense	probably damaging	0.99
R1355:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1370:Pros1	UTSW	16	62919558	missense	probably benign	0.23
R1517:Pros1	UTSW	16	62885512	missense	probably damaging	0.98
R1866:Pros1	UTSW	16	62928135	missense	possibly damaging	0.86
R1876:Pros1	UTSW	16	62903518	missense	probably damaging	0.96
R2255:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R2364:Pros1	UTSW	16	62913848	missense	probably damaging	0.99
R2369:Pros1	UTSW	16	62928069	missense	probably damaging	1.00
R2979:Pros1	UTSW	16	62913866	missense	probably damaging	0.99
R3724:Pros1	UTSW	16	62900329	missense	possibly damaging	0.86
R4056:Pros1	UTSW	16	62900645	nonsense	probably null
R4556:Pros1	UTSW	16	62900673	missense	possibly damaging	0.95
R4688:Pros1	UTSW	16	62889007	critical splice donor site	probably null
R4850:Pros1	UTSW	16	62885524	missense	probably damaging	0.98
R4923:Pros1	UTSW	16	62903572	missense	possibly damaging	0.86
R5008:Pros1	UTSW	16	62928185	missense	possibly damaging	0.53
R5370:Pros1	UTSW	16	62913976	missense	probably benign	0.01
R5580:Pros1	UTSW	16	62926326	critical splice acceptor site	probably null
R5930:Pros1	UTSW	16	62928061	missense	probably damaging	0.96
R5974:Pros1	UTSW	16	62900667	missense	probably damaging	0.98
R6233:Pros1	UTSW	16	62898921	missense	possibly damaging	0.47
R6949:Pros1	UTSW	16	62924575	missense	probably benign	0.01
R7055:Pros1	UTSW	16	62928102	missense	possibly damaging	0.85
R7347:Pros1	UTSW	16	62919523	missense	probably damaging	0.97
R7375:Pros1	UTSW	16	62924550	missense	probably damaging	0.96
R7419:Pros1	UTSW	16	62928070	nonsense	probably null
R7980:Pros1	UTSW	16	62928153	missense	possibly damaging	0.86
R8479:Pros1	UTSW	16	62907739	missense	probably damaging	1.00
R8514:Pros1	UTSW	16	62910109	missense	probably benign	0.03
R8827:Pros1	UTSW	16	62926464	missense	probably benign	0.13
R9131:Pros1	UTSW	16	62928034	missense	probably damaging	0.96
R9484:Pros1	UTSW	16	62924524	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- CTAATGGTCAGACACTGTTTCCAC -3'
(R):5'- CTGTTAGCATTTAGTCACGTGG -3'

Sequencing Primer
(F):5'- ACAGATATTTCCTTCAGTGCCACAC -3'
(R):5'- TCGTCTTCTGAGAAAAACAGGAC -3'

Posted On

2020-07-13