Incidental Mutation 'R8235:Olfr1104'
ID637290
Institutional Source Beutler Lab
Gene Symbol Olfr1104
Ensembl Gene ENSMUSG00000075166
Gene Nameolfactory receptor 1104
SynonymsGA_x6K02T2Q125-48508763-48507833, MOR207-1
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.846) question?
Stock #R8235 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location87020703-87027080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87021882 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 221 (I221V)
Ref Sequence ENSEMBL: ENSMUSP00000097454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099869]
Predicted Effect probably benign
Transcript: ENSMUST00000099869
AA Change: I221V

PolyPhen 2 Score 0.356 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000097454
Gene: ENSMUSG00000075166
AA Change: I221V

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 9.3e-48 PFAM
Pfam:7tm_1 41 289 2.3e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930467E23Rik C A 8: 19,749,460 T308N probably benign Het
Abca13 A C 11: 9,262,077 Q279H probably damaging Het
Abhd13 G A 8: 9,987,394 probably benign Het
Atp8b3 T C 10: 80,529,816 N368S probably damaging Het
Bptf A G 11: 107,076,632 M1089T probably benign Het
Cbll1 C T 12: 31,491,571 D103N probably benign Het
Ccnd2 T C 6: 127,130,342 D288G probably benign Het
Chek1 T A 9: 36,719,574 R181S probably benign Het
Chrna7 T C 7: 63,212,224 R27G probably damaging Het
Crybb1 A G 5: 112,257,400 K6R probably damaging Het
Ehbp1 G A 11: 22,239,153 T83M probably damaging Het
Entpd7 G A 19: 43,717,545 E269K probably damaging Het
Eps8 A G 6: 137,483,578 V729A possibly damaging Het
Farsa A G 8: 84,868,916 H480R probably damaging Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Hpn T C 7: 31,102,783 T228A possibly damaging Het
Lyst T A 13: 13,760,738 H3597Q possibly damaging Het
Msto1 A T 3: 88,912,921 L89Q probably damaging Het
Mycbp2 T C 14: 103,198,674 E2185G probably damaging Het
Myh2 A G 11: 67,192,998 E1534G probably damaging Het
Nfkbia T C 12: 55,490,823 Y195C probably damaging Het
Npr2 T A 4: 43,641,603 M469K probably benign Het
Nwd1 TCATCC TCATCCATCC 8: 72,711,686 probably null Het
Nwd1 TCC TCCAACC 8: 72,711,689 probably null Het
Prdm2 G A 4: 143,132,467 Q1418* probably null Het
Ptk2 T C 15: 73,343,291 T13A probably benign Het
Ptprk T A 10: 28,589,041 N1292K possibly damaging Het
Ptprq A C 10: 107,582,541 V1658G probably damaging Het
Ptprq A T 10: 107,705,490 F392I probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Samd4b C T 7: 28,406,606 V396I probably benign Het
Spta1 T A 1: 174,202,386 L906Q probably damaging Het
Sytl1 T C 4: 133,260,946 D33G probably damaging Het
Tbx4 TCGCCGCCGCCGCCGC TCGCCGCCGCCGC 11: 85,890,232 probably benign Het
Trmt10c T C 16: 56,034,576 N232S probably benign Het
Trpc4 G A 3: 54,302,248 C678Y probably benign Het
Tulp3 T C 6: 128,327,677 N205D probably benign Het
Ufl1 T C 4: 25,278,656 I100V probably benign Het
Unc45b A G 11: 82,919,855 I314V probably benign Het
Vegfa A T 17: 46,031,310 L194Q possibly damaging Het
Vps13c T C 9: 67,927,396 F1669S probably damaging Het
Vps13c T A 9: 67,955,781 H3026Q probably benign Het
Zfp184 T G 13: 21,959,883 I586M probably damaging Het
Other mutations in Olfr1104
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Olfr1104 APN 2 87021884 missense probably damaging 1.00
IGL02533:Olfr1104 APN 2 87022353 missense probably damaging 1.00
IGL02662:Olfr1104 APN 2 87022002 missense probably benign 0.09
IGL02704:Olfr1104 APN 2 87022277 missense probably benign 0.00
R0145:Olfr1104 UTSW 2 87021790 nonsense probably null
R0625:Olfr1104 UTSW 2 87021620 missense probably benign
R1169:Olfr1104 UTSW 2 87021717 missense probably damaging 1.00
R1570:Olfr1104 UTSW 2 87022272 missense probably benign
R1727:Olfr1104 UTSW 2 87022263 missense probably damaging 1.00
R2146:Olfr1104 UTSW 2 87021665 missense probably damaging 1.00
R2192:Olfr1104 UTSW 2 87022511 missense probably benign 0.01
R3716:Olfr1104 UTSW 2 87022363 nonsense probably null
R3818:Olfr1104 UTSW 2 87021710 missense probably benign 0.02
R4711:Olfr1104 UTSW 2 87022026 missense probably damaging 1.00
R6104:Olfr1104 UTSW 2 87021713 missense probably damaging 1.00
R6482:Olfr1104 UTSW 2 87022525 missense probably benign 0.00
R7474:Olfr1104 UTSW 2 87022554 start gained probably benign
R7517:Olfr1104 UTSW 2 87022142 missense probably benign 0.45
R7610:Olfr1104 UTSW 2 87021797 missense possibly damaging 0.59
R7944:Olfr1104 UTSW 2 87022313 missense probably benign 0.01
R7945:Olfr1104 UTSW 2 87022313 missense probably benign 0.01
X0019:Olfr1104 UTSW 2 87021635 missense probably benign 0.00
Z1177:Olfr1104 UTSW 2 87021618 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTAGAACACAGAGGCTACCTG -3'
(R):5'- AACTGGCTGGCAGTAATACCATAC -3'

Sequencing Primer
(F):5'- CAGAGGCTACCTGTGCTTG -3'
(R):5'- CCATCTGTGTGATAAGCAGTTTGCC -3'
Posted On2020-07-13