Incidental Mutation 'R8235:Npr2'
ID637295
Institutional Source Beutler Lab
Gene Symbol Npr2
Ensembl Gene ENSMUSG00000028469
Gene Namenatriuretic peptide receptor 2
Synonymspwe, cn, guanylyl cyclase-B
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.648) question?
Stock #R8235 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location43631935-43651244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 43641603 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 469 (M469K)
Ref Sequence ENSEMBL: ENSMUSP00000030191 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000107874]
Predicted Effect probably benign
Transcript: ENSMUST00000030191
AA Change: M469K

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469
AA Change: M469K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107874
AA Change: M469K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469
AA Change: M469K

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Predicted Effect
SMART Domains Protein: ENSMUSP00000117761
Gene: ENSMUSG00000028469
AA Change: M40K

DomainStartEndE-ValueType
transmembrane domain 28 50 N/A INTRINSIC
Pfam:Pkinase_Tyr 71 173 1.3e-12 PFAM
Pfam:Pkinase 85 170 1.2e-10 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469
AA Change: M34K

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Pkinase_Tyr 84 352 1e-39 PFAM
Pfam:Pkinase 101 351 2.6e-33 PFAM
CYCc 391 585 3.28e-111 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes natriuretic peptide receptor B, one of two integral membrane receptors for natriuretic peptides. Both NPR1 and NPR2 contain five functional domains: an extracellular ligand-binding domain, a single membrane-spanning region, and intracellularly a protein kinase homology domain, a helical hinge region involved in oligomerization, and a carboxyl-terminal guanylyl cyclase catalytic domain. The protein is the primary receptor for C-type natriuretic peptide (CNP), which upon ligand binding exhibits greatly increased guanylyl cyclase activity. Mutations in this gene are the cause of acromesomelic dysplasia Maroteaux type. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in skeletal abnormalities, malocclusion, and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930467E23Rik C A 8: 19,749,460 T308N probably benign Het
Abca13 A C 11: 9,262,077 Q279H probably damaging Het
Abhd13 G A 8: 9,987,394 probably benign Het
Atp8b3 T C 10: 80,529,816 N368S probably damaging Het
Bptf A G 11: 107,076,632 M1089T probably benign Het
Cbll1 C T 12: 31,491,571 D103N probably benign Het
Ccnd2 T C 6: 127,130,342 D288G probably benign Het
Chek1 T A 9: 36,719,574 R181S probably benign Het
Chrna7 T C 7: 63,212,224 R27G probably damaging Het
Crybb1 A G 5: 112,257,400 K6R probably damaging Het
Ehbp1 G A 11: 22,239,153 T83M probably damaging Het
Entpd7 G A 19: 43,717,545 E269K probably damaging Het
Eps8 A G 6: 137,483,578 V729A possibly damaging Het
Farsa A G 8: 84,868,916 H480R probably damaging Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Hpn T C 7: 31,102,783 T228A possibly damaging Het
Lyst T A 13: 13,760,738 H3597Q possibly damaging Het
Msto1 A T 3: 88,912,921 L89Q probably damaging Het
Mycbp2 T C 14: 103,198,674 E2185G probably damaging Het
Myh2 A G 11: 67,192,998 E1534G probably damaging Het
Nfkbia T C 12: 55,490,823 Y195C probably damaging Het
Nwd1 TCATCC TCATCCATCC 8: 72,711,686 probably null Het
Nwd1 TCC TCCAACC 8: 72,711,689 probably null Het
Olfr1104 T C 2: 87,021,882 I221V probably benign Het
Prdm2 G A 4: 143,132,467 Q1418* probably null Het
Ptk2 T C 15: 73,343,291 T13A probably benign Het
Ptprk T A 10: 28,589,041 N1292K possibly damaging Het
Ptprq A C 10: 107,582,541 V1658G probably damaging Het
Ptprq A T 10: 107,705,490 F392I probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Samd4b C T 7: 28,406,606 V396I probably benign Het
Spta1 T A 1: 174,202,386 L906Q probably damaging Het
Sytl1 T C 4: 133,260,946 D33G probably damaging Het
Tbx4 TCGCCGCCGCCGCCGC TCGCCGCCGCCGC 11: 85,890,232 probably benign Het
Trmt10c T C 16: 56,034,576 N232S probably benign Het
Trpc4 G A 3: 54,302,248 C678Y probably benign Het
Tulp3 T C 6: 128,327,677 N205D probably benign Het
Ufl1 T C 4: 25,278,656 I100V probably benign Het
Unc45b A G 11: 82,919,855 I314V probably benign Het
Vegfa A T 17: 46,031,310 L194Q possibly damaging Het
Vps13c T C 9: 67,927,396 F1669S probably damaging Het
Vps13c T A 9: 67,955,781 H3026Q probably benign Het
Zfp184 T G 13: 21,959,883 I586M probably damaging Het
Other mutations in Npr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Npr2 APN 4 43641612 missense possibly damaging 0.51
IGL01116:Npr2 APN 4 43640248 missense probably damaging 0.99
IGL01447:Npr2 APN 4 43640554 missense possibly damaging 0.93
IGL02412:Npr2 APN 4 43647005 missense probably damaging 0.97
IGL02449:Npr2 APN 4 43646641 missense probably damaging 1.00
IGL03120:Npr2 APN 4 43643133 missense probably damaging 0.99
IGL03351:Npr2 APN 4 43640652 missense probably benign 0.36
palmer UTSW 4 43647553 missense probably damaging 1.00
R0066:Npr2 UTSW 4 43632329 missense probably benign 0.00
R0201:Npr2 UTSW 4 43641617 missense probably damaging 0.98
R0309:Npr2 UTSW 4 43640904 unclassified probably benign
R0437:Npr2 UTSW 4 43648082 missense probably damaging 1.00
R0440:Npr2 UTSW 4 43650315 missense probably damaging 0.99
R0464:Npr2 UTSW 4 43640597 splice site probably null
R0511:Npr2 UTSW 4 43632801 missense probably benign 0.00
R0576:Npr2 UTSW 4 43640947 missense probably benign 0.01
R0630:Npr2 UTSW 4 43641219 missense probably benign 0.18
R0690:Npr2 UTSW 4 43646991 missense probably damaging 0.98
R1079:Npr2 UTSW 4 43643654 missense probably damaging 1.00
R1140:Npr2 UTSW 4 43648353 missense possibly damaging 0.87
R1171:Npr2 UTSW 4 43647260 missense possibly damaging 0.52
R1741:Npr2 UTSW 4 43643350 missense probably damaging 1.00
R1848:Npr2 UTSW 4 43632384 missense probably benign
R1864:Npr2 UTSW 4 43641258 missense probably benign 0.30
R1919:Npr2 UTSW 4 43640578 missense probably damaging 1.00
R2054:Npr2 UTSW 4 43646560 missense probably damaging 0.99
R2106:Npr2 UTSW 4 43644329 missense probably damaging 1.00
R2143:Npr2 UTSW 4 43648166 missense probably damaging 1.00
R2306:Npr2 UTSW 4 43633609 missense probably damaging 1.00
R2372:Npr2 UTSW 4 43650432 missense probably damaging 1.00
R2889:Npr2 UTSW 4 43641600 missense probably benign 0.26
R3076:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3078:Npr2 UTSW 4 43640182 missense probably damaging 1.00
R3711:Npr2 UTSW 4 43643378 missense probably benign 0.00
R3730:Npr2 UTSW 4 43640999 missense possibly damaging 0.93
R4301:Npr2 UTSW 4 43641332 critical splice donor site probably null
R4352:Npr2 UTSW 4 43646592 missense probably damaging 1.00
R4412:Npr2 UTSW 4 43644150 missense probably damaging 0.99
R4583:Npr2 UTSW 4 43633522 splice site probably null
R4593:Npr2 UTSW 4 43647323 unclassified probably benign
R5042:Npr2 UTSW 4 43647002 missense probably damaging 1.00
R5213:Npr2 UTSW 4 43640673 critical splice donor site probably null
R5546:Npr2 UTSW 4 43650150 missense probably damaging 1.00
R5784:Npr2 UTSW 4 43632801 missense probably benign 0.00
R5787:Npr2 UTSW 4 43633593 missense possibly damaging 0.69
R6364:Npr2 UTSW 4 43643622 missense probably damaging 1.00
R6925:Npr2 UTSW 4 43647553 missense probably damaging 1.00
R6949:Npr2 UTSW 4 43640597 missense probably damaging 1.00
R7380:Npr2 UTSW 4 43641254 missense probably damaging 1.00
R7432:Npr2 UTSW 4 43647155 missense probably damaging 0.96
R7500:Npr2 UTSW 4 43650415 missense probably damaging 1.00
R8292:Npr2 UTSW 4 43643086 missense possibly damaging 0.70
Z1176:Npr2 UTSW 4 43650720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACTTGGACGACCCATCC -3'
(R):5'- GGACCAAATTCAAAGGCCAG -3'

Sequencing Primer
(F):5'- TTGGACGACCCATCCTGTGATAAAAG -3'
(R):5'- CCAGAGAGAAAGCTGCCAGTC -3'
Posted On2020-07-13