Mutagenetix > Incidental Mutations

Incidental Mutation 'R8235:Prdm2'

637297

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R8235 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 143132467 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 1418 (Q1418*)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

Predicted Effect

probably null
Transcript: ENSMUST00000105778
AA Change: Q1418*

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: Q1418*

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.8%
10x: 99.5%
20x: 98.8%

Validation Efficiency

98% (44/45)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930467E23Rik	C	A	8: 19,749,460	T308N	probably benign	Het
Abca13	A	C	11: 9,262,077	Q279H	probably damaging	Het
Abhd13	G	A	8: 9,987,394		probably benign	Het
Atp8b3	T	C	10: 80,529,816	N368S	probably damaging	Het
Bptf	A	G	11: 107,076,632	M1089T	probably benign	Het
Cbll1	C	T	12: 31,491,571	D103N	probably benign	Het
Ccnd2	T	C	6: 127,130,342	D288G	probably benign	Het
Chek1	T	A	9: 36,719,574	R181S	probably benign	Het
Chrna7	T	C	7: 63,212,224	R27G	probably damaging	Het
Crybb1	A	G	5: 112,257,400	K6R	probably damaging	Het
Ehbp1	G	A	11: 22,239,153	T83M	probably damaging	Het
Entpd7	G	A	19: 43,717,545	E269K	probably damaging	Het
Eps8	A	G	6: 137,483,578	V729A	possibly damaging	Het
Farsa	A	G	8: 84,868,916	H480R	probably damaging	Het
Gm10110	C	T	14: 89,898,241	V76M	noncoding transcript	Het
Hpn	T	C	7: 31,102,783	T228A	possibly damaging	Het
Lyst	T	A	13: 13,760,738	H3597Q	possibly damaging	Het
Map3k4	A	T	17: 12,240,081		probably null	Het
Msto1	A	T	3: 88,912,921	L89Q	probably damaging	Het
Mycbp2	T	C	14: 103,198,674	E2185G	probably damaging	Het
Myh2	A	G	11: 67,192,998	E1534G	probably damaging	Het
Nfkbia	T	C	12: 55,490,823	Y195C	probably damaging	Het
Npr2	T	A	4: 43,641,603	M469K	probably benign	Het
Nwd1	TCATCC	TCATCCATCC	8: 72,711,686		probably null	Het
Olfr1104	T	C	2: 87,021,882	I221V	probably benign	Het
Ptk2	T	C	15: 73,343,291	T13A	probably benign	Het
Ptprk	T	A	10: 28,589,041	N1292K	possibly damaging	Het
Ptprq	A	C	10: 107,582,541	V1658G	probably damaging	Het
Ptprq	A	T	10: 107,705,490	F392I	probably benign	Het
Rbm46	C	T	3: 82,865,468	R119Q	probably benign	Het
Rsf1	T	C	7: 97,676,254		probably benign	Het
Samd4b	C	T	7: 28,406,606	V396I	probably benign	Het
Spta1	T	A	1: 174,202,386	L906Q	probably damaging	Het
Sytl1	T	C	4: 133,260,946	D33G	probably damaging	Het
Trmt10c	T	C	16: 56,034,576	N232S	probably benign	Het
Trpc4	G	A	3: 54,302,248	C678Y	probably benign	Het
Tulp3	T	C	6: 128,327,677	N205D	probably benign	Het
Ufl1	T	C	4: 25,278,656	I100V	probably benign	Het
Unc45b	A	G	11: 82,919,855	I314V	probably benign	Het
Vegfa	A	T	17: 46,031,310	L194Q	possibly damaging	Het
Vps13c	T	C	9: 67,927,396	F1669S	probably damaging	Het
Vps13c	T	A	9: 67,955,781	H3026Q	probably benign	Het
Zfp184	T	G	13: 21,959,883	I586M	probably damaging	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2112:Prdm2	UTSW	4	143131936	missense	probably benign
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACTTTTCTTTTGGAAGGAGAAAGGG -3'
(R):5'- CACATCTTGGCGTGTGCATC -3'

Sequencing Primer
(F):5'- GTCACAGTAAGGGCAGAT -3'
(R):5'- TAAGAAAAACCCAGTGCCGCTG -3'

Posted On

2020-07-13