Incidental Mutation 'R8235:Tulp3'
ID 637300
Institutional Source Beutler Lab
Gene Symbol Tulp3
Ensembl Gene ENSMUSG00000001521
Gene Name tubby-like protein 3
Synonyms 2310022L06Rik
MMRRC Submission 067667-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R8235 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 128298124-128332814 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 128304640 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 205 (N205D)
Ref Sequence ENSEMBL: ENSMUSP00000001562 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001562]
AlphaFold O88413
Predicted Effect probably benign
Transcript: ENSMUST00000001562
AA Change: N205D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000001562
Gene: ENSMUSG00000001521
AA Change: N205D

DomainStartEndE-ValueType
Pfam:Tub_N 30 84 1.7e-23 PFAM
Pfam:Tub_N 76 198 5.5e-16 PFAM
Pfam:Tub 213 454 1e-87 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tubby gene family of bipartite transcription factors. Members of this family have been identified in plants, vertebrates, and invertebrates, and they share a conserved N-terminal transcription activation region and a conserved C-terminal DNA and phosphatidylinositol-phosphate binding region. The encoded protein binds to phosphoinositides in the plasma membrane via its C-terminal region and probably functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis, for instance, induced by G-protein-coupled-receptor signaling. It plays an important role in neuronal development and function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mutant mice exhibit failed neural tube closure followed by neuroepithelial apoptosis and ultimately embryonic death around E14.5. Heterozygotes are largely phenotypically normal, however some exhibit neuroepithelial apoptosis and die as embryos. [provided by MGI curators]
Allele List at MGI

All alleles(35) : Targeted, other(3) Gene trapped(31) Chemically induced(1)

Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,212,077 (GRCm39) Q279H probably damaging Het
Abhd13 G A 8: 10,037,394 (GRCm39) probably benign Het
Atp8b3 T C 10: 80,365,650 (GRCm39) N368S probably damaging Het
Bptf A G 11: 106,967,458 (GRCm39) M1089T probably benign Het
Cbll1 C T 12: 31,541,570 (GRCm39) D103N probably benign Het
Ccnd2 T C 6: 127,107,305 (GRCm39) D288G probably benign Het
Chek1 T A 9: 36,630,870 (GRCm39) R181S probably benign Het
Chrna7 T C 7: 62,861,972 (GRCm39) R27G probably damaging Het
Crybb1 A G 5: 112,405,266 (GRCm39) K6R probably damaging Het
Ehbp1 G A 11: 22,189,153 (GRCm39) T83M probably damaging Het
Entpd7 G A 19: 43,705,984 (GRCm39) E269K probably damaging Het
Eps8 A G 6: 137,460,576 (GRCm39) V729A possibly damaging Het
Farsa A G 8: 85,595,545 (GRCm39) H480R probably damaging Het
Gm10110 C T 14: 90,135,677 (GRCm39) V76M noncoding transcript Het
Hpn T C 7: 30,802,208 (GRCm39) T228A possibly damaging Het
Lyst T A 13: 13,935,323 (GRCm39) H3597Q possibly damaging Het
Map3k4 A T 17: 12,458,968 (GRCm39) probably null Het
Msto1 A T 3: 88,820,228 (GRCm39) L89Q probably damaging Het
Mycbp2 T C 14: 103,436,110 (GRCm39) E2185G probably damaging Het
Myh2 A G 11: 67,083,824 (GRCm39) E1534G probably damaging Het
Nfkbia T C 12: 55,537,608 (GRCm39) Y195C probably damaging Het
Npr2 T A 4: 43,641,603 (GRCm39) M469K probably benign Het
Nwd1 TCATCC TCATCCATCC 8: 73,438,314 (GRCm39) probably null Het
Or8i2 T C 2: 86,852,226 (GRCm39) I221V probably benign Het
Potefam3e C A 8: 19,799,476 (GRCm39) T308N probably benign Het
Prdm2 G A 4: 142,859,037 (GRCm39) Q1418* probably null Het
Ptk2 T C 15: 73,215,140 (GRCm39) T13A probably benign Het
Ptprk T A 10: 28,465,037 (GRCm39) N1292K possibly damaging Het
Ptprq A C 10: 107,418,402 (GRCm39) V1658G probably damaging Het
Ptprq A T 10: 107,541,351 (GRCm39) F392I probably benign Het
Rbm46 C T 3: 82,772,775 (GRCm39) R119Q probably benign Het
Rsf1 T C 7: 97,325,461 (GRCm39) probably benign Het
Samd4b C T 7: 28,106,031 (GRCm39) V396I probably benign Het
Spta1 T A 1: 174,029,952 (GRCm39) L906Q probably damaging Het
Sytl1 T C 4: 132,988,257 (GRCm39) D33G probably damaging Het
Trmt10c T C 16: 55,854,939 (GRCm39) N232S probably benign Het
Trpc4 G A 3: 54,209,669 (GRCm39) C678Y probably benign Het
Ufl1 T C 4: 25,278,656 (GRCm39) I100V probably benign Het
Unc45b A G 11: 82,810,681 (GRCm39) I314V probably benign Het
Vegfa A T 17: 46,342,236 (GRCm39) L194Q possibly damaging Het
Vps13c T C 9: 67,834,678 (GRCm39) F1669S probably damaging Het
Vps13c T A 9: 67,863,063 (GRCm39) H3026Q probably benign Het
Zfp184 T G 13: 22,144,053 (GRCm39) I586M probably damaging Het
Other mutations in Tulp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Tulp3 APN 6 128,302,847 (GRCm39) missense probably damaging 0.99
IGL01327:Tulp3 APN 6 128,304,597 (GRCm39) missense probably damaging 1.00
IGL01382:Tulp3 APN 6 128,302,033 (GRCm39) missense probably damaging 1.00
IGL01633:Tulp3 APN 6 128,302,923 (GRCm39) missense probably damaging 1.00
IGL02228:Tulp3 APN 6 128,311,448 (GRCm39) missense probably damaging 1.00
IGL02372:Tulp3 APN 6 128,304,561 (GRCm39) missense possibly damaging 0.92
D4043:Tulp3 UTSW 6 128,301,113 (GRCm39) missense probably benign 0.06
R0243:Tulp3 UTSW 6 128,302,921 (GRCm39) nonsense probably null
R1181:Tulp3 UTSW 6 128,302,915 (GRCm39) missense possibly damaging 0.47
R1673:Tulp3 UTSW 6 128,310,906 (GRCm39) splice site probably null
R1749:Tulp3 UTSW 6 128,314,722 (GRCm39) missense probably damaging 1.00
R1984:Tulp3 UTSW 6 128,303,769 (GRCm39) missense probably benign 0.02
R1985:Tulp3 UTSW 6 128,303,769 (GRCm39) missense probably benign 0.02
R2568:Tulp3 UTSW 6 128,304,601 (GRCm39) missense probably benign 0.00
R4660:Tulp3 UTSW 6 128,300,017 (GRCm39) utr 3 prime probably benign
R4779:Tulp3 UTSW 6 128,300,083 (GRCm39) missense probably damaging 1.00
R5001:Tulp3 UTSW 6 128,302,031 (GRCm39) missense probably damaging 1.00
R6192:Tulp3 UTSW 6 128,332,703 (GRCm39) splice site probably null
R6242:Tulp3 UTSW 6 128,300,050 (GRCm39) missense probably damaging 1.00
R7464:Tulp3 UTSW 6 128,303,792 (GRCm39) missense probably benign 0.00
R7782:Tulp3 UTSW 6 128,301,943 (GRCm39) missense possibly damaging 0.69
R7883:Tulp3 UTSW 6 128,303,807 (GRCm39) missense probably damaging 1.00
R8027:Tulp3 UTSW 6 128,311,436 (GRCm39) missense probably benign 0.00
R8919:Tulp3 UTSW 6 128,310,966 (GRCm39) missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- CACTAGAAGAAAGCGGCCTG -3'
(R):5'- AAGTGTTTACCTCAGGGCTC -3'

Sequencing Primer
(F):5'- CCAGGTGCATATAGTAGGTG -3'
(R):5'- CCCTTGGCTAGAGGAGTGAAGAC -3'
Posted On 2020-07-13