Incidental Mutation 'R8235:Atp8b3'
ID637314
Institutional Source Beutler Lab
Gene Symbol Atp8b3
Ensembl Gene ENSMUSG00000003341
Gene NameATPase, class I, type 8B, member 3
Synonyms1700042F02Rik, SAPLT, 1700056N23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock #R8235 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location80519584-80539124 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80529816 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 368 (N368S)
Ref Sequence ENSEMBL: ENSMUSP00000020383 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020383]
Predicted Effect probably damaging
Transcript: ENSMUST00000020383
AA Change: N368S

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000020383
Gene: ENSMUSG00000003341
AA Change: N368S

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 20 97 9.3e-29 PFAM
Pfam:E1-E2_ATPase 121 367 2.2e-10 PFAM
Pfam:HAD 404 866 3.7e-17 PFAM
Pfam:Cation_ATPase 481 580 8.3e-12 PFAM
Pfam:PhoLip_ATPase_C 883 1135 4.2e-61 PFAM
low complexity region 1140 1153 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to the other. This gene encodes member 3 of phospholipid-transporting ATPase 8B; other members of this protein family are located on chromosomes 1, 15 and 18. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Litters sired by homozygous mutant mice are smaller than those sired by wild-type males. While sperm morphology and motility is intact in null sperm, fertilization rates are reduced due to impaired sperm-egg interactions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930467E23Rik C A 8: 19,749,460 T308N probably benign Het
Abca13 A C 11: 9,262,077 Q279H probably damaging Het
Abhd13 G A 8: 9,987,394 probably benign Het
Bptf A G 11: 107,076,632 M1089T probably benign Het
Cbll1 C T 12: 31,491,571 D103N probably benign Het
Ccnd2 T C 6: 127,130,342 D288G probably benign Het
Chek1 T A 9: 36,719,574 R181S probably benign Het
Chrna7 T C 7: 63,212,224 R27G probably damaging Het
Crybb1 A G 5: 112,257,400 K6R probably damaging Het
Ehbp1 G A 11: 22,239,153 T83M probably damaging Het
Entpd7 G A 19: 43,717,545 E269K probably damaging Het
Eps8 A G 6: 137,483,578 V729A possibly damaging Het
Farsa A G 8: 84,868,916 H480R probably damaging Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Hpn T C 7: 31,102,783 T228A possibly damaging Het
Lyst T A 13: 13,760,738 H3597Q possibly damaging Het
Msto1 A T 3: 88,912,921 L89Q probably damaging Het
Mycbp2 T C 14: 103,198,674 E2185G probably damaging Het
Myh2 A G 11: 67,192,998 E1534G probably damaging Het
Nfkbia T C 12: 55,490,823 Y195C probably damaging Het
Npr2 T A 4: 43,641,603 M469K probably benign Het
Nwd1 TCATCC TCATCCATCC 8: 72,711,686 probably null Het
Nwd1 TCC TCCAACC 8: 72,711,689 probably null Het
Olfr1104 T C 2: 87,021,882 I221V probably benign Het
Prdm2 G A 4: 143,132,467 Q1418* probably null Het
Ptk2 T C 15: 73,343,291 T13A probably benign Het
Ptprk T A 10: 28,589,041 N1292K possibly damaging Het
Ptprq A C 10: 107,582,541 V1658G probably damaging Het
Ptprq A T 10: 107,705,490 F392I probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Samd4b C T 7: 28,406,606 V396I probably benign Het
Spta1 T A 1: 174,202,386 L906Q probably damaging Het
Sytl1 T C 4: 133,260,946 D33G probably damaging Het
Tbx4 TCGCCGCCGCCGCCGC TCGCCGCCGCCGC 11: 85,890,232 probably benign Het
Trmt10c T C 16: 56,034,576 N232S probably benign Het
Trpc4 G A 3: 54,302,248 C678Y probably benign Het
Tulp3 T C 6: 128,327,677 N205D probably benign Het
Ufl1 T C 4: 25,278,656 I100V probably benign Het
Unc45b A G 11: 82,919,855 I314V probably benign Het
Vegfa A T 17: 46,031,310 L194Q possibly damaging Het
Vps13c T C 9: 67,927,396 F1669S probably damaging Het
Vps13c T A 9: 67,955,781 H3026Q probably benign Het
Zfp184 T G 13: 21,959,883 I586M probably damaging Het
Other mutations in Atp8b3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Atp8b3 APN 10 80530987 missense probably damaging 1.00
IGL00484:Atp8b3 APN 10 80526164 splice site probably benign
IGL00904:Atp8b3 APN 10 80528764 missense probably damaging 1.00
IGL01326:Atp8b3 APN 10 80524376 missense probably damaging 0.98
IGL01368:Atp8b3 APN 10 80534229 splice site probably benign
IGL01448:Atp8b3 APN 10 80520422 missense probably benign 0.02
IGL01556:Atp8b3 APN 10 80530968 nonsense probably null
IGL01754:Atp8b3 APN 10 80530961 splice site probably null
IGL01809:Atp8b3 APN 10 80520011 missense probably benign 0.02
IGL01895:Atp8b3 APN 10 80521828 missense possibly damaging 0.80
IGL02184:Atp8b3 APN 10 80527233 splice site probably benign
IGL02224:Atp8b3 APN 10 80525976 splice site probably benign
IGL02377:Atp8b3 APN 10 80520294 missense probably benign 0.06
IGL02405:Atp8b3 APN 10 80530628 missense probably damaging 1.00
IGL03090:Atp8b3 APN 10 80530604 missense probably damaging 1.00
IGL03244:Atp8b3 APN 10 80534458 missense probably damaging 1.00
PIT4544001:Atp8b3 UTSW 10 80530586 missense probably benign 0.14
R0277:Atp8b3 UTSW 10 80526909 missense probably benign 0.21
R0908:Atp8b3 UTSW 10 80520084 missense probably benign 0.03
R0973:Atp8b3 UTSW 10 80534198 missense probably damaging 1.00
R1069:Atp8b3 UTSW 10 80531018 missense probably damaging 1.00
R1087:Atp8b3 UTSW 10 80520183 missense probably benign 0.00
R1553:Atp8b3 UTSW 10 80532542 missense probably damaging 1.00
R1603:Atp8b3 UTSW 10 80525785 missense probably benign 0.06
R1606:Atp8b3 UTSW 10 80532578 missense probably damaging 1.00
R1707:Atp8b3 UTSW 10 80521801 splice site probably null
R1717:Atp8b3 UTSW 10 80528797 missense probably damaging 1.00
R1876:Atp8b3 UTSW 10 80530078 missense possibly damaging 0.70
R1939:Atp8b3 UTSW 10 80525386 nonsense probably null
R2138:Atp8b3 UTSW 10 80527105 missense possibly damaging 0.79
R2239:Atp8b3 UTSW 10 80530988 missense probably damaging 1.00
R2429:Atp8b3 UTSW 10 80526894 missense probably benign 0.02
R2696:Atp8b3 UTSW 10 80534183 missense possibly damaging 0.94
R2910:Atp8b3 UTSW 10 80519912 missense possibly damaging 0.90
R3424:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3425:Atp8b3 UTSW 10 80536347 missense probably benign 0.35
R3432:Atp8b3 UTSW 10 80526180 missense probably benign 0.10
R3841:Atp8b3 UTSW 10 80529706 missense possibly damaging 0.95
R4515:Atp8b3 UTSW 10 80523847 missense probably benign
R4518:Atp8b3 UTSW 10 80523847 missense probably benign
R4519:Atp8b3 UTSW 10 80523847 missense probably benign
R4619:Atp8b3 UTSW 10 80526024 missense possibly damaging 0.67
R4648:Atp8b3 UTSW 10 80525623 missense possibly damaging 0.94
R4709:Atp8b3 UTSW 10 80536770 splice site probably null
R4774:Atp8b3 UTSW 10 80536322 missense probably damaging 1.00
R4796:Atp8b3 UTSW 10 80524354 missense probably damaging 1.00
R5000:Atp8b3 UTSW 10 80521842 missense possibly damaging 0.82
R5398:Atp8b3 UTSW 10 80529699 missense probably damaging 1.00
R5778:Atp8b3 UTSW 10 80520173 missense probably benign
R5990:Atp8b3 UTSW 10 80525697 missense possibly damaging 0.65
R6124:Atp8b3 UTSW 10 80529681 missense probably damaging 1.00
R6427:Atp8b3 UTSW 10 80520323 splice site probably null
R6748:Atp8b3 UTSW 10 80525224 missense possibly damaging 0.56
R6756:Atp8b3 UTSW 10 80526061 missense possibly damaging 0.76
R7051:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7051:Atp8b3 UTSW 10 80529718 missense probably damaging 0.99
R7052:Atp8b3 UTSW 10 80520024 missense probably benign 0.02
R7418:Atp8b3 UTSW 10 80530092 missense probably damaging 0.99
R7426:Atp8b3 UTSW 10 80529629 critical splice donor site probably null
R7625:Atp8b3 UTSW 10 80520146 missense probably benign 0.00
R7673:Atp8b3 UTSW 10 80524406 missense probably damaging 0.99
R7921:Atp8b3 UTSW 10 80530603 missense probably damaging 1.00
R8077:Atp8b3 UTSW 10 80531024 missense possibly damaging 0.95
R8354:Atp8b3 UTSW 10 80525799 missense probably benign 0.00
RF006:Atp8b3 UTSW 10 80526236 missense probably benign 0.15
Z1177:Atp8b3 UTSW 10 80531077 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCAGCCATTGATACAGCACTTC -3'
(R):5'- GTGAAACAGTTCAAAGCCAAGC -3'

Sequencing Primer
(F):5'- CAGCACTTCTTGAAGGTCATG -3'
(R):5'- GACGCGATGGAGTCCTTCTTC -3'
Posted On2020-07-13