Incidental Mutation 'R8235:Gm10110'
ID637327
Institutional Source Beutler Lab
Gene Symbol Gm10110
Ensembl Gene ENSMUSG00000062093
Gene Namepredicted gene 10110
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.209) question?
Stock #R8235 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location89896223-89898466 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 89898241 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 76 (V76M)
Ref Sequence ENSEMBL: ENSMUSP00000079967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081204]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000081204
AA Change: V76M
SMART Domains Protein: ENSMUSP00000079967
Gene: ENSMUSG00000062093
AA Change: V76M

DomainStartEndE-ValueType
RRM 12 85 1.47e-21 SMART
RRM 100 171 2.91e-25 SMART
RRM 192 264 1.27e-25 SMART
RRM 295 366 1.92e-25 SMART
low complexity region 478 493 N/A INTRINSIC
low complexity region 503 516 N/A INTRINSIC
PolyA 534 597 4.49e-41 SMART
Meta Mutation Damage Score 0.1229 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 98% (44/45)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930467E23Rik C A 8: 19,749,460 T308N probably benign Het
Abca13 A C 11: 9,262,077 Q279H probably damaging Het
Abhd13 G A 8: 9,987,394 probably benign Het
Atp8b3 T C 10: 80,529,816 N368S probably damaging Het
Bptf A G 11: 107,076,632 M1089T probably benign Het
Cbll1 C T 12: 31,491,571 D103N probably benign Het
Ccnd2 T C 6: 127,130,342 D288G probably benign Het
Chek1 T A 9: 36,719,574 R181S probably benign Het
Chrna7 T C 7: 63,212,224 R27G probably damaging Het
Crybb1 A G 5: 112,257,400 K6R probably damaging Het
Ehbp1 G A 11: 22,239,153 T83M probably damaging Het
Entpd7 G A 19: 43,717,545 E269K probably damaging Het
Eps8 A G 6: 137,483,578 V729A possibly damaging Het
Farsa A G 8: 84,868,916 H480R probably damaging Het
Hpn T C 7: 31,102,783 T228A possibly damaging Het
Lyst T A 13: 13,760,738 H3597Q possibly damaging Het
Map3k4 A T 17: 12,240,081 probably null Het
Msto1 A T 3: 88,912,921 L89Q probably damaging Het
Mycbp2 T C 14: 103,198,674 E2185G probably damaging Het
Myh2 A G 11: 67,192,998 E1534G probably damaging Het
Nfkbia T C 12: 55,490,823 Y195C probably damaging Het
Npr2 T A 4: 43,641,603 M469K probably benign Het
Nwd1 TCATCC TCATCCATCC 8: 72,711,686 probably null Het
Olfr1104 T C 2: 87,021,882 I221V probably benign Het
Prdm2 G A 4: 143,132,467 Q1418* probably null Het
Ptk2 T C 15: 73,343,291 T13A probably benign Het
Ptprk T A 10: 28,589,041 N1292K possibly damaging Het
Ptprq A C 10: 107,582,541 V1658G probably damaging Het
Ptprq A T 10: 107,705,490 F392I probably benign Het
Rbm46 C T 3: 82,865,468 R119Q probably benign Het
Rsf1 T C 7: 97,676,254 probably benign Het
Samd4b C T 7: 28,406,606 V396I probably benign Het
Spta1 T A 1: 174,202,386 L906Q probably damaging Het
Sytl1 T C 4: 133,260,946 D33G probably damaging Het
Trmt10c T C 16: 56,034,576 N232S probably benign Het
Trpc4 G A 3: 54,302,248 C678Y probably benign Het
Tulp3 T C 6: 128,327,677 N205D probably benign Het
Ufl1 T C 4: 25,278,656 I100V probably benign Het
Unc45b A G 11: 82,919,855 I314V probably benign Het
Vegfa A T 17: 46,031,310 L194Q possibly damaging Het
Vps13c T C 9: 67,927,396 F1669S probably damaging Het
Vps13c T A 9: 67,955,781 H3026Q probably benign Het
Zfp184 T G 13: 21,959,883 I586M probably damaging Het
Other mutations in Gm10110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Gm10110 APN 14 89898241 exon noncoding transcript
IGL02308:Gm10110 APN 14 89897595 exon noncoding transcript
IGL02977:Gm10110 APN 14 89897332 exon noncoding transcript
IGL03230:Gm10110 APN 14 89898297 exon noncoding transcript
R0966:Gm10110 UTSW 14 89898119 exon noncoding transcript
R1466:Gm10110 UTSW 14 89898075 exon noncoding transcript
R1466:Gm10110 UTSW 14 89898075 exon noncoding transcript
R1640:Gm10110 UTSW 14 89898243 exon noncoding transcript
R1762:Gm10110 UTSW 14 89897389 exon noncoding transcript
R1839:Gm10110 UTSW 14 89897836 exon noncoding transcript
R2679:Gm10110 UTSW 14 89897416 exon noncoding transcript
R3907:Gm10110 UTSW 14 89898147 exon noncoding transcript
R4512:Gm10110 UTSW 14 89897715 exon noncoding transcript
R4513:Gm10110 UTSW 14 89897715 exon noncoding transcript
R4590:Gm10110 UTSW 14 89897546 exon noncoding transcript
R4877:Gm10110 UTSW 14 89897349 exon noncoding transcript
R5771:Gm10110 UTSW 14 89897239 exon noncoding transcript
R6333:Gm10110 UTSW 14 89898297 exon noncoding transcript
R6341:Gm10110 UTSW 14 89896708 exon noncoding transcript
R8236:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8237:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8281:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8282:Gm10110 UTSW 14 89898241 missense noncoding transcript
R8283:Gm10110 UTSW 14 89898241 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- TCTTGGGTCTCGAAGTGAAC -3'
(R):5'- CTTATACGTGGGCGATTTGC -3'

Sequencing Primer
(F):5'- AGCATAGCCCTTAGAGCCGTTC -3'
(R):5'- GATTTGCACTCGGACGTCAC -3'
Posted On2020-07-13