Incidental Mutation 'R8236:Cdk5rap2'
ID637344
Institutional Source Beutler Lab
Gene Symbol Cdk5rap2
Ensembl Gene ENSMUSG00000039298
Gene NameCDK5 regulatory subunit associated protein 2
Synonyms2900018K03Rik, an
MMRRC Submission
Accession Numbers

Genbank: NM_145990.3

Is this an essential gene? Possibly non essential (E-score: 0.491) question?
Stock #R8236 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location70216856-70410443 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 70242485 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 1579 (P1579Q)
Ref Sequence ENSEMBL: ENSMUSP00000119891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000138561] [ENSMUST00000144099]
Predicted Effect probably benign
Transcript: ENSMUST00000076541
Predicted Effect probably benign
Transcript: ENSMUST00000138561
AA Change: P328Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116928
Gene: ENSMUSG00000039298
AA Change: P328Q

DomainStartEndE-ValueType
Blast:BRLZ 228 284 1e-13 BLAST
low complexity region 297 314 N/A INTRINSIC
low complexity region 368 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144099
AA Change: P1579Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: P1579Q

DomainStartEndE-ValueType
Pfam:Cnn_1N 58 130 3.6e-26 PFAM
coiled coil region 210 345 N/A INTRINSIC
low complexity region 368 381 N/A INTRINSIC
coiled coil region 388 462 N/A INTRINSIC
coiled coil region 569 616 N/A INTRINSIC
low complexity region 761 776 N/A INTRINSIC
low complexity region 791 800 N/A INTRINSIC
coiled coil region 960 1001 N/A INTRINSIC
coiled coil region 1112 1140 N/A INTRINSIC
coiled coil region 1200 1237 N/A INTRINSIC
Blast:BRLZ 1479 1535 6e-13 BLAST
low complexity region 1548 1565 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
low complexity region 1700 1711 N/A INTRINSIC
low complexity region 1811 1822 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]
Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik C T 1: 86,046,393 A144V possibly damaging Het
Actr8 A G 14: 29,982,628 I51M probably damaging Het
Afm A T 5: 90,523,888 D143V probably damaging Het
Ankfy1 T A 11: 72,754,355 S753R possibly damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Birc6 G C 17: 74,611,131 L1845F probably damaging Het
Brip1 C A 11: 86,139,112 D569Y probably damaging Het
Cab39 T C 1: 85,848,371 L263P probably damaging Het
Cblb C A 16: 52,166,029 P545Q possibly damaging Het
Ccdc64 T C 5: 115,649,559 H527R probably benign Het
Cdt1 A G 8: 122,572,028 E468G probably damaging Het
Col28a1 A G 6: 8,097,024 probably null Het
Coro2a A G 4: 46,548,796 I166T possibly damaging Het
Ctnnd2 G A 15: 30,647,018 A287T probably benign Het
Dcc C T 18: 71,955,018 V50I probably benign Het
Defb30 A T 14: 63,049,767 M19K unknown Het
Dync2h1 C A 9: 7,080,363 probably benign Het
Edc4 A G 8: 105,892,273 T1291A possibly damaging Het
Epyc A T 10: 97,681,205 N302Y probably damaging Het
Espn G A 4: 152,149,030 T106I probably damaging Het
Fam135a T C 1: 24,020,648 probably null Het
Fam171b G A 2: 83,880,206 E741K probably damaging Het
Fgfr1 G T 8: 25,562,272 E205* probably null Het
Flt3 A G 5: 147,356,860 S469P probably benign Het
Gdpd3 A G 7: 126,768,666 K224E probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm43518 C T 5: 123,934,222 Q17* probably null Het
Gm4353 T C 7: 116,083,383 Y321C probably damaging Het
Gphn A G 12: 78,664,537 H631R probably damaging Het
Hook1 T A 4: 96,014,805 probably null Het
Il9 T A 13: 56,482,245 probably benign Het
Itpr2 A G 6: 146,390,783 probably null Het
Lhcgr A T 17: 88,742,586 L504* probably null Het
Mical3 A G 6: 121,012,543 V272A Het
Mup10 A G 4: 60,581,563 I63T probably damaging Het
Mxi1 C G 19: 53,369,598 P165R probably damaging Het
Nanog A T 6: 122,713,172 I179F probably benign Het
Olfr1137 T A 2: 87,711,760 I49F possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pip A G 6: 41,847,662 D28G probably damaging Het
Ppp2r3d T C 9: 124,440,067 H53R Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Ptpn4 A G 1: 119,678,822 V781A possibly damaging Het
Ptprt C T 2: 161,687,068 probably null Het
Rtf1 T C 2: 119,701,214 S141P probably damaging Het
Slc2a1 G C 4: 119,133,257 S226T probably benign Het
Smyd3 A C 1: 179,405,640 probably null Het
Sos1 T C 17: 80,408,283 E1015G probably benign Het
Sult1b1 G T 5: 87,521,524 T155N probably damaging Het
Tcam1 A G 11: 106,286,417 I412V probably benign Het
Tet2 G A 3: 133,487,786 P296S probably benign Het
Tmem30c T C 16: 57,276,179 D193G probably null Het
Trem2 G T 17: 48,351,906 W233L probably benign Het
Trpm3 C A 19: 22,987,408 D1422E probably benign Het
Ttbk1 T G 17: 46,470,729 D366A probably damaging Het
Ttyh1 G A 7: 4,125,548 G148D probably benign Het
Ubr2 T C 17: 46,951,909 M1259V probably benign Het
Zfp608 T A 18: 54,899,209 D553V probably damaging Het
Zkscan2 A G 7: 123,479,912 S941P probably benign Het
Zranb1 T C 7: 132,949,664 Y15H probably damaging Het
Other mutations in Cdk5rap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Cdk5rap2 APN 4 70403472 critical splice donor site probably null
IGL01305:Cdk5rap2 APN 4 70380235 missense possibly damaging 0.52
IGL01987:Cdk5rap2 APN 4 70302082 critical splice donor site probably null
IGL02213:Cdk5rap2 APN 4 70317602 splice site probably benign
IGL02732:Cdk5rap2 APN 4 70266665 nonsense probably null
IGL03063:Cdk5rap2 APN 4 70354877 critical splice acceptor site probably null
IGL03244:Cdk5rap2 APN 4 70281435 missense probably benign 0.19
ANU22:Cdk5rap2 UTSW 4 70380235 missense possibly damaging 0.52
F5426:Cdk5rap2 UTSW 4 70254803 missense probably benign
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0010:Cdk5rap2 UTSW 4 70243459 missense probably benign 0.01
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0044:Cdk5rap2 UTSW 4 70360901 missense probably damaging 1.00
R0482:Cdk5rap2 UTSW 4 70410269 start gained probably benign
R0548:Cdk5rap2 UTSW 4 70349142 critical splice donor site probably null
R0594:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R0737:Cdk5rap2 UTSW 4 70337375 missense probably benign 0.01
R0788:Cdk5rap2 UTSW 4 70307231 missense possibly damaging 0.90
R0960:Cdk5rap2 UTSW 4 70243508 missense probably benign 0.03
R1682:Cdk5rap2 UTSW 4 70302150 missense possibly damaging 0.92
R1727:Cdk5rap2 UTSW 4 70272679 missense probably benign
R1727:Cdk5rap2 UTSW 4 70289972 missense possibly damaging 0.70
R1768:Cdk5rap2 UTSW 4 70307233 missense probably benign 0.09
R1903:Cdk5rap2 UTSW 4 70403554 splice site probably null
R2270:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2271:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2272:Cdk5rap2 UTSW 4 70266678 missense probably benign 0.01
R2364:Cdk5rap2 UTSW 4 70360809 critical splice donor site probably null
R2763:Cdk5rap2 UTSW 4 70281271 missense probably benign
R2893:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2894:Cdk5rap2 UTSW 4 70289873 missense probably benign
R2958:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2959:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2961:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2962:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R2963:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3522:Cdk5rap2 UTSW 4 70250410 missense probably damaging 1.00
R3725:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3726:Cdk5rap2 UTSW 4 70235437 missense possibly damaging 0.89
R3876:Cdk5rap2 UTSW 4 70289977 frame shift probably null
R3919:Cdk5rap2 UTSW 4 70380223 missense possibly damaging 0.50
R4025:Cdk5rap2 UTSW 4 70250387 missense probably damaging 0.98
R4324:Cdk5rap2 UTSW 4 70353614 missense probably damaging 1.00
R4485:Cdk5rap2 UTSW 4 70239283 critical splice donor site probably null
R4516:Cdk5rap2 UTSW 4 70276715 splice site probably null
R4556:Cdk5rap2 UTSW 4 70239312 missense probably damaging 0.97
R4560:Cdk5rap2 UTSW 4 70315331 missense probably benign 0.03
R4584:Cdk5rap2 UTSW 4 70266760 missense probably damaging 1.00
R4620:Cdk5rap2 UTSW 4 70266706 missense probably benign 0.00
R4639:Cdk5rap2 UTSW 4 70302176 missense probably damaging 0.97
R4755:Cdk5rap2 UTSW 4 70238425 missense probably damaging 1.00
R4947:Cdk5rap2 UTSW 4 70228592 splice site probably null
R5116:Cdk5rap2 UTSW 4 70307238 missense possibly damaging 0.67
R5449:Cdk5rap2 UTSW 4 70276651 missense probably benign 0.00
R5643:Cdk5rap2 UTSW 4 70266733 missense probably damaging 0.99
R5899:Cdk5rap2 UTSW 4 70243593 splice site probably benign
R6177:Cdk5rap2 UTSW 4 70281482 missense probably damaging 0.99
R6254:Cdk5rap2 UTSW 4 70364032 missense probably damaging 1.00
R6326:Cdk5rap2 UTSW 4 70235454 missense probably damaging 1.00
R6335:Cdk5rap2 UTSW 4 70266612 missense possibly damaging 0.79
R6534:Cdk5rap2 UTSW 4 70354813 missense probably damaging 0.98
R6857:Cdk5rap2 UTSW 4 70245396 nonsense probably null
R6959:Cdk5rap2 UTSW 4 70360669 splice site probably null
R7104:Cdk5rap2 UTSW 4 70349156 missense probably benign 0.00
R7145:Cdk5rap2 UTSW 4 70238231 missense probably benign 0.13
R7223:Cdk5rap2 UTSW 4 70235447 missense probably benign 0.02
R7234:Cdk5rap2 UTSW 4 70376787 splice site probably null
R7240:Cdk5rap2 UTSW 4 70291908 missense probably damaging 1.00
R7247:Cdk5rap2 UTSW 4 70337429 missense probably damaging 1.00
R7382:Cdk5rap2 UTSW 4 70290025 missense probably benign 0.19
R7413:Cdk5rap2 UTSW 4 70254735 missense probably damaging 1.00
R7576:Cdk5rap2 UTSW 4 70266872 missense probably benign 0.01
R8434:Cdk5rap2 UTSW 4 70364020 missense probably benign 0.00
Z1176:Cdk5rap2 UTSW 4 70266743 missense probably damaging 0.99
Predicted Primers
Posted On2020-07-13