Incidental Mutation 'R0726:Aox1'
ID 63736
Institutional Source Beutler Lab
Gene Symbol Aox1
Ensembl Gene ENSMUSG00000063558
Gene Name aldehyde oxidase 1
Synonyms Aox-1, retinal oxidase, Aox-2, Aox2
MMRRC Submission 038908-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0726 (G1)
Quality Score 104
Status Validated
Chromosome 1
Chromosomal Location 58069090-58145572 bp(+) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 58373941 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110006 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114366]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000114366
SMART Domains Protein: ENSMUSP00000110006
Gene: ENSMUSG00000079554

DomainStartEndE-ValueType
Pfam:Fer2 13 83 3.4e-9 PFAM
Pfam:Fer2_2 92 166 4.2e-30 PFAM
Pfam:FAD_binding_5 241 421 5.1e-46 PFAM
CO_deh_flav_C 428 532 1.4e-23 SMART
Ald_Xan_dh_C 604 707 4.64e-47 SMART
Pfam:Ald_Xan_dh_C2 717 1251 1.3e-178 PFAM
low complexity region 1257 1271 N/A INTRINSIC
low complexity region 1285 1303 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 89.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aldehyde oxidase produces hydrogen peroxide and, under certain conditions, can catalyze the formation of superoxide. Aldehyde oxidase is a candidate gene for amyotrophic lateral sclerosis. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acte1 A G 7: 143,425,498 (GRCm39) D49G probably damaging Het
Alg12 T C 15: 88,690,850 (GRCm39) Y256C probably damaging Het
Alox15 T A 11: 70,241,021 (GRCm39) D160V probably damaging Het
Bbs9 G T 9: 22,705,119 (GRCm39) A729S probably damaging Het
Bltp3a T C 17: 28,104,463 (GRCm39) V503A possibly damaging Het
Bmp2k T A 5: 97,235,353 (GRCm39) probably benign Het
Braf C T 6: 39,639,082 (GRCm39) R223Q possibly damaging Het
Cd101 A T 3: 100,927,938 (GRCm39) S48T possibly damaging Het
Cdh9 T G 15: 16,831,130 (GRCm39) D322E probably benign Het
Col28a1 C T 6: 8,014,495 (GRCm39) probably null Het
Cpxm1 G A 2: 130,232,859 (GRCm39) R712W probably damaging Het
Csnk1g1 T C 9: 65,939,637 (GRCm39) probably benign Het
Cyp2d37-ps A C 15: 82,574,650 (GRCm39) noncoding transcript Het
Cyth3 T C 5: 143,678,397 (GRCm39) V115A probably benign Het
Dnah9 C T 11: 65,856,507 (GRCm39) V2885M probably damaging Het
Dock9 G T 14: 121,889,180 (GRCm39) Y326* probably null Het
Espl1 T C 15: 102,231,033 (GRCm39) I1844T probably benign Het
Fam20a T A 11: 109,568,020 (GRCm39) N357Y probably damaging Het
Fancc C A 13: 63,471,225 (GRCm39) R385L probably benign Het
Foxe3 A T 4: 114,782,447 (GRCm39) L255H unknown Het
Frem2 T C 3: 53,427,047 (GRCm39) D2967G possibly damaging Het
Gabra6 T G 11: 42,205,954 (GRCm39) T301P probably damaging Het
Ganab T A 19: 8,888,477 (GRCm39) Y511N probably damaging Het
Grm4 T A 17: 27,657,412 (GRCm39) probably benign Het
H1f6 G T 13: 23,880,307 (GRCm39) K153N possibly damaging Het
Kcnj9 G A 1: 172,153,488 (GRCm39) S212F probably damaging Het
Kif15 C A 9: 122,788,993 (GRCm39) H62N probably benign Het
Kptn A G 7: 15,854,647 (GRCm39) D106G probably damaging Het
Krtap13-1 T A 16: 88,526,192 (GRCm39) S139T probably damaging Het
Lepr C A 4: 101,622,131 (GRCm39) N354K probably benign Het
Lypd3 G T 7: 24,337,969 (GRCm39) E112* probably null Het
Med13l A T 5: 118,886,749 (GRCm39) N1550I probably damaging Het
Mettl2 C T 11: 105,017,670 (GRCm39) P60L probably benign Het
Mtcl2 G T 2: 156,902,182 (GRCm39) R278S probably damaging Het
Muc4 A G 16: 32,590,201 (GRCm39) E850G probably damaging Het
Mylk G C 16: 34,699,845 (GRCm39) E403Q possibly damaging Het
Nek1 A G 8: 61,542,626 (GRCm39) R739G probably damaging Het
Nipbl A T 15: 8,381,039 (GRCm39) D584E probably benign Het
Nkain3 C T 4: 20,158,388 (GRCm39) V162M possibly damaging Het
Nmrk1 T C 19: 18,618,844 (GRCm39) probably benign Het
Nsd2 T C 5: 34,018,372 (GRCm39) probably benign Het
Or2n1b T C 17: 38,459,515 (GRCm39) F12S probably damaging Het
Or4b1 T A 2: 89,979,627 (GRCm39) H241L probably damaging Het
Or4p23 A T 2: 88,576,352 (GRCm39) N293K probably benign Het
Or5b24 T A 19: 12,912,969 (GRCm39) V289D probably damaging Het
Or8b44 T A 9: 38,410,418 (GRCm39) M151K possibly damaging Het
Otulinl A T 15: 27,657,033 (GRCm39) I338N probably damaging Het
Phex T A X: 156,155,557 (GRCm39) probably benign Het
Pip5k1b G T 19: 24,356,256 (GRCm39) D227E probably damaging Het
Prdm13 A G 4: 21,683,914 (GRCm39) I119T unknown Het
Rab19 G T 6: 39,360,893 (GRCm39) V14L probably benign Het
Rasa3 A G 8: 13,630,118 (GRCm39) probably benign Het
Rgsl1 C T 1: 153,678,074 (GRCm39) S118N probably damaging Het
Rif1 C T 2: 52,000,365 (GRCm39) T1273M possibly damaging Het
Scn8a A G 15: 100,870,711 (GRCm39) N254S probably damaging Het
Sema6a T C 18: 47,425,048 (GRCm39) T188A probably damaging Het
Sh3pxd2a C T 19: 47,257,201 (GRCm39) E506K probably damaging Het
Smarca2 A T 19: 26,675,803 (GRCm39) K1014N probably damaging Het
Smarca4 T G 9: 21,611,435 (GRCm39) probably null Het
Sntb1 T C 15: 55,539,752 (GRCm39) R361G probably benign Het
Stx5a T A 19: 8,732,275 (GRCm39) I208N probably damaging Het
Tas2r102 T A 6: 132,739,415 (GRCm39) W108R probably damaging Het
Tcl1 A G 12: 105,184,929 (GRCm39) Y94H probably damaging Het
Tenm3 T A 8: 48,689,629 (GRCm39) Y1986F probably damaging Het
Tet2 G A 3: 133,173,945 (GRCm39) P1439L probably benign Het
Tiam2 T C 17: 3,563,108 (GRCm39) probably benign Het
Ubap2l G A 3: 89,928,553 (GRCm39) T526M probably damaging Het
Ugcg C T 4: 59,207,798 (GRCm39) P46S probably benign Het
Ushbp1 T A 8: 71,841,391 (GRCm39) probably benign Het
Usp28 C T 9: 48,915,169 (GRCm39) R115C probably damaging Het
Vldlr A T 19: 27,215,786 (GRCm39) D261V probably damaging Het
Vmn2r5 C T 3: 64,411,186 (GRCm39) D461N probably benign Het
Vmn2r86 A T 10: 130,282,265 (GRCm39) F784I probably damaging Het
Zfp59 A T 7: 27,553,513 (GRCm39) I322F probably damaging Het
Zfp607a A T 7: 27,578,574 (GRCm39) H548L probably benign Het
Zfp626 G A 7: 27,518,048 (GRCm39) C343Y probably damaging Het
Other mutations in Aox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00336:Aox1 APN 1 58,098,203 (GRCm39) missense probably damaging 1.00
IGL01014:Aox1 APN 1 58,361,960 (GRCm39) missense possibly damaging 0.73
IGL01077:Aox1 APN 1 58,096,569 (GRCm39) splice site probably benign
IGL01288:Aox1 APN 1 58,333,566 (GRCm39) missense probably damaging 0.99
IGL01335:Aox1 APN 1 58,121,312 (GRCm39) nonsense probably null
IGL01383:Aox1 APN 1 58,333,464 (GRCm39) missense probably benign 0.09
IGL01410:Aox1 APN 1 58,145,184 (GRCm39) splice site probably null
IGL01684:Aox1 APN 1 58,116,740 (GRCm39) splice site probably null
IGL01727:Aox1 APN 1 58,112,387 (GRCm39) nonsense probably null
IGL01734:Aox1 APN 1 58,393,469 (GRCm39) missense possibly damaging 0.95
IGL01793:Aox1 APN 1 58,375,783 (GRCm39) missense possibly damaging 0.79
IGL01805:Aox1 APN 1 58,120,672 (GRCm39) missense possibly damaging 0.94
IGL01834:Aox1 APN 1 58,348,183 (GRCm39) missense possibly damaging 0.90
IGL01924:Aox1 APN 1 58,326,902 (GRCm39) missense possibly damaging 0.90
IGL01996:Aox1 APN 1 58,121,225 (GRCm39) missense probably benign 0.11
IGL02060:Aox1 APN 1 58,137,114 (GRCm39) missense possibly damaging 0.95
IGL02206:Aox1 APN 1 58,104,499 (GRCm39) missense probably benign 0.00
IGL02591:Aox1 APN 1 58,398,158 (GRCm39) nonsense probably null
IGL02645:Aox1 APN 1 58,373,883 (GRCm39) missense probably damaging 1.00
IGL02710:Aox1 APN 1 58,373,928 (GRCm39) critical splice donor site probably null
IGL02801:Aox1 APN 1 58,393,336 (GRCm39) missense probably damaging 1.00
IGL02839:Aox1 APN 1 58,107,943 (GRCm39) missense probably benign 0.05
IGL02975:Aox1 APN 1 58,107,550 (GRCm39) missense probably damaging 1.00
IGL02988:Aox1 APN 1 58,376,509 (GRCm39) missense probably benign
IGL03062:Aox1 APN 1 58,117,624 (GRCm39) missense probably benign 0.01
IGL03104:Aox1 APN 1 58,321,918 (GRCm39) missense probably benign
IGL03121:Aox1 APN 1 58,398,113 (GRCm39) missense probably damaging 1.00
IGL03191:Aox1 APN 1 58,398,228 (GRCm39) missense probably null 0.98
IGL03236:Aox1 APN 1 58,349,156 (GRCm39) nonsense probably null
IGL03286:Aox1 APN 1 58,088,543 (GRCm39) missense probably benign 0.19
IGL03335:Aox1 APN 1 58,115,319 (GRCm39) missense probably damaging 0.98
IGL03395:Aox1 APN 1 58,107,884 (GRCm39) splice site probably benign
IGL03409:Aox1 APN 1 58,393,588 (GRCm39) missense possibly damaging 0.91
PIT4362001:Aox1 UTSW 1 58,321,839 (GRCm39) missense probably damaging 1.00
R0035:Aox1 UTSW 1 58,393,581 (GRCm39) missense probably benign 0.00
R0035:Aox1 UTSW 1 58,393,581 (GRCm39) missense probably benign 0.00
R0048:Aox1 UTSW 1 58,112,371 (GRCm39) missense probably damaging 0.98
R0144:Aox1 UTSW 1 58,109,233 (GRCm39) missense probably benign 0.00
R0207:Aox1 UTSW 1 58,144,173 (GRCm39) missense possibly damaging 0.82
R0267:Aox1 UTSW 1 58,378,605 (GRCm39) splice site probably benign
R0357:Aox1 UTSW 1 58,131,675 (GRCm39) missense probably damaging 1.00
R0383:Aox1 UTSW 1 58,100,400 (GRCm39) missense probably benign 0.00
R0388:Aox1 UTSW 1 58,393,565 (GRCm39) missense probably damaging 1.00
R0399:Aox1 UTSW 1 58,108,008 (GRCm39) splice site probably null
R0409:Aox1 UTSW 1 58,375,783 (GRCm39) missense possibly damaging 0.90
R0465:Aox1 UTSW 1 58,101,366 (GRCm39) missense probably damaging 1.00
R0480:Aox1 UTSW 1 58,082,810 (GRCm39) splice site probably benign
R0547:Aox1 UTSW 1 58,349,201 (GRCm39) missense probably damaging 0.96
R0630:Aox1 UTSW 1 58,376,480 (GRCm39) splice site probably benign
R0734:Aox1 UTSW 1 58,344,500 (GRCm39) missense probably benign 0.22
R0831:Aox1 UTSW 1 58,378,842 (GRCm39) missense probably benign 0.28
R0961:Aox1 UTSW 1 58,349,230 (GRCm39) missense probably benign 0.00
R1005:Aox1 UTSW 1 58,104,511 (GRCm39) missense probably benign 0.00
R1404:Aox1 UTSW 1 58,385,371 (GRCm39) splice site probably benign
R1507:Aox1 UTSW 1 58,143,610 (GRCm39) missense probably benign 0.01
R1512:Aox1 UTSW 1 58,346,510 (GRCm39) missense probably benign 0.00
R1573:Aox1 UTSW 1 58,348,186 (GRCm39) missense probably benign 0.00
R1592:Aox1 UTSW 1 58,339,853 (GRCm39) missense probably benign 0.00
R1597:Aox1 UTSW 1 58,086,326 (GRCm39) missense probably damaging 1.00
R1693:Aox1 UTSW 1 58,124,701 (GRCm39) missense probably damaging 1.00
R1709:Aox1 UTSW 1 58,116,633 (GRCm39) missense probably benign
R1747:Aox1 UTSW 1 58,378,751 (GRCm39) missense probably benign 0.01
R1768:Aox1 UTSW 1 58,393,354 (GRCm39) missense probably benign 0.00
R1809:Aox1 UTSW 1 58,333,484 (GRCm39) missense probably benign
R1823:Aox1 UTSW 1 58,351,518 (GRCm39) missense probably benign 0.02
R1834:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1835:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1836:Aox1 UTSW 1 58,348,150 (GRCm39) missense probably benign 0.08
R1869:Aox1 UTSW 1 58,115,262 (GRCm39) missense probably damaging 1.00
R1870:Aox1 UTSW 1 58,115,262 (GRCm39) missense probably damaging 1.00
R1898:Aox1 UTSW 1 58,117,601 (GRCm39) missense probably damaging 1.00
R1908:Aox1 UTSW 1 58,141,783 (GRCm39) missense probably damaging 1.00
R2002:Aox1 UTSW 1 58,086,300 (GRCm39) missense possibly damaging 0.69
R2062:Aox1 UTSW 1 58,098,351 (GRCm39) splice site probably null
R2065:Aox1 UTSW 1 58,098,351 (GRCm39) splice site probably null
R2219:Aox1 UTSW 1 58,388,289 (GRCm39) splice site probably null
R2220:Aox1 UTSW 1 58,388,289 (GRCm39) splice site probably null
R2265:Aox1 UTSW 1 58,120,679 (GRCm39) missense probably damaging 0.99
R2508:Aox1 UTSW 1 58,382,832 (GRCm39) missense probably benign 0.38
R2942:Aox1 UTSW 1 58,376,540 (GRCm39) missense probably benign 0.03
R2967:Aox1 UTSW 1 58,361,993 (GRCm39) missense probably damaging 0.96
R3082:Aox1 UTSW 1 58,322,759 (GRCm39) splice site probably benign
R3161:Aox1 UTSW 1 58,343,597 (GRCm39) missense possibly damaging 0.91
R3408:Aox1 UTSW 1 58,382,827 (GRCm39) missense probably benign 0.32
R3713:Aox1 UTSW 1 58,095,374 (GRCm39) missense probably benign 0.01
R3778:Aox1 UTSW 1 58,092,862 (GRCm39) missense possibly damaging 0.89
R3803:Aox1 UTSW 1 58,329,058 (GRCm39) splice site probably null
R3894:Aox1 UTSW 1 58,373,837 (GRCm39) critical splice acceptor site probably null
R4198:Aox1 UTSW 1 58,124,766 (GRCm39) missense probably benign
R4214:Aox1 UTSW 1 58,346,603 (GRCm39) critical splice donor site probably null
R4249:Aox1 UTSW 1 58,338,978 (GRCm39) missense probably benign 0.01
R4296:Aox1 UTSW 1 58,096,559 (GRCm39) splice site probably null
R4562:Aox1 UTSW 1 58,098,215 (GRCm39) missense probably damaging 0.99
R4666:Aox1 UTSW 1 58,343,756 (GRCm39) nonsense probably null
R4668:Aox1 UTSW 1 58,373,853 (GRCm39) missense possibly damaging 0.63
R4703:Aox1 UTSW 1 58,398,116 (GRCm39) missense possibly damaging 0.78
R4758:Aox1 UTSW 1 58,371,741 (GRCm39) missense probably benign 0.00
R4858:Aox1 UTSW 1 58,143,640 (GRCm39) missense probably benign
R4862:Aox1 UTSW 1 58,134,316 (GRCm39) missense probably damaging 0.98
R4890:Aox1 UTSW 1 58,373,862 (GRCm39) missense probably benign 0.11
R4900:Aox1 UTSW 1 58,344,544 (GRCm39) missense probably benign
R4924:Aox1 UTSW 1 58,344,503 (GRCm39) missense probably damaging 1.00
R4970:Aox1 UTSW 1 58,349,254 (GRCm39) splice site probably null
R5048:Aox1 UTSW 1 58,098,641 (GRCm39) splice site probably benign
R5112:Aox1 UTSW 1 58,349,254 (GRCm39) splice site probably null
R5127:Aox1 UTSW 1 58,069,185 (GRCm39) missense probably benign 0.00
R5139:Aox1 UTSW 1 58,100,456 (GRCm39) missense probably benign 0.03
R5157:Aox1 UTSW 1 58,109,222 (GRCm39) missense probably damaging 1.00
R5168:Aox1 UTSW 1 58,088,561 (GRCm39) missense probably damaging 1.00
R5186:Aox1 UTSW 1 58,107,529 (GRCm39) missense probably damaging 1.00
R5235:Aox1 UTSW 1 58,096,714 (GRCm39) missense possibly damaging 0.77
R5289:Aox1 UTSW 1 58,131,717 (GRCm39) missense probably damaging 0.99
R5466:Aox1 UTSW 1 58,080,619 (GRCm39) missense probably damaging 1.00
R5540:Aox1 UTSW 1 58,143,569 (GRCm39) missense probably benign 0.03
R5615:Aox1 UTSW 1 58,136,125 (GRCm39) missense probably benign
R5652:Aox1 UTSW 1 58,134,356 (GRCm39) missense probably damaging 1.00
R5920:Aox1 UTSW 1 58,088,631 (GRCm39) missense probably damaging 1.00
R5987:Aox1 UTSW 1 58,346,518 (GRCm39) missense probably benign 0.00
R6008:Aox1 UTSW 1 58,116,672 (GRCm39) missense probably damaging 1.00
R6073:Aox1 UTSW 1 58,143,668 (GRCm39) critical splice donor site probably null
R6215:Aox1 UTSW 1 58,124,620 (GRCm39) missense probably benign
R6239:Aox1 UTSW 1 58,344,550 (GRCm39) critical splice donor site probably null
R6273:Aox1 UTSW 1 58,378,831 (GRCm39) missense probably benign 0.00
R6291:Aox1 UTSW 1 58,369,965 (GRCm39) missense probably damaging 0.98
R6334:Aox1 UTSW 1 58,346,566 (GRCm39) nonsense probably null
R6403:Aox1 UTSW 1 58,107,594 (GRCm39) missense probably damaging 1.00
R6440:Aox1 UTSW 1 58,133,631 (GRCm39) missense probably damaging 1.00
R6601:Aox1 UTSW 1 58,102,665 (GRCm39) missense probably damaging 1.00
R6608:Aox1 UTSW 1 58,096,705 (GRCm39) missense probably benign 0.40
R6752:Aox1 UTSW 1 58,086,398 (GRCm39) missense probably benign 0.00
R6764:Aox1 UTSW 1 58,389,441 (GRCm39) missense probably damaging 0.97
R6766:Aox1 UTSW 1 58,388,227 (GRCm39) missense possibly damaging 0.95
R6789:Aox1 UTSW 1 58,343,644 (GRCm39) missense probably benign 0.01
R6804:Aox1 UTSW 1 58,343,757 (GRCm39) missense probably benign 0.04
R6989:Aox1 UTSW 1 58,124,611 (GRCm39) missense probably damaging 1.00
R7007:Aox1 UTSW 1 58,370,051 (GRCm39) missense probably damaging 1.00
R7015:Aox1 UTSW 1 58,321,917 (GRCm39) missense probably benign 0.00
R7042:Aox1 UTSW 1 58,141,759 (GRCm39) missense probably damaging 0.99
R7055:Aox1 UTSW 1 58,338,927 (GRCm39) missense probably benign 0.08
R7089:Aox1 UTSW 1 58,375,808 (GRCm39) missense probably benign 0.01
R7157:Aox1 UTSW 1 58,322,651 (GRCm39) missense probably benign 0.00
R7303:Aox1 UTSW 1 58,373,924 (GRCm39) nonsense probably null
R7426:Aox1 UTSW 1 58,329,142 (GRCm39) nonsense probably null
R7442:Aox1 UTSW 1 58,121,172 (GRCm39) missense probably damaging 1.00
R7506:Aox1 UTSW 1 58,088,562 (GRCm39) missense probably damaging 1.00
R7563:Aox1 UTSW 1 58,086,304 (GRCm39) missense probably benign 0.32
R7589:Aox1 UTSW 1 58,080,643 (GRCm39) missense probably damaging 1.00
R7735:Aox1 UTSW 1 58,107,451 (GRCm39) missense probably benign 0.01
R7762:Aox1 UTSW 1 58,388,263 (GRCm39) missense probably damaging 1.00
R7814:Aox1 UTSW 1 58,124,626 (GRCm39) missense probably benign
R7876:Aox1 UTSW 1 58,101,330 (GRCm39) nonsense probably null
R7899:Aox1 UTSW 1 58,320,396 (GRCm39) splice site probably null
R7905:Aox1 UTSW 1 58,143,557 (GRCm39) missense possibly damaging 0.72
R7908:Aox1 UTSW 1 58,145,227 (GRCm39) missense possibly damaging 0.68
R7942:Aox1 UTSW 1 58,376,590 (GRCm39) missense probably damaging 1.00
R7975:Aox1 UTSW 1 58,348,187 (GRCm39) missense probably benign 0.02
R8029:Aox1 UTSW 1 58,382,827 (GRCm39) missense probably benign 0.32
R8032:Aox1 UTSW 1 58,389,442 (GRCm39) missense probably benign 0.01
R8116:Aox1 UTSW 1 58,115,283 (GRCm39) missense probably damaging 1.00
R8147:Aox1 UTSW 1 58,339,821 (GRCm39) missense probably benign 0.02
R8165:Aox1 UTSW 1 58,348,088 (GRCm39) missense probably benign 0.08
R8179:Aox1 UTSW 1 58,137,117 (GRCm39) missense probably damaging 1.00
R8264:Aox1 UTSW 1 58,092,873 (GRCm39) missense possibly damaging 0.92
R8284:Aox1 UTSW 1 58,115,250 (GRCm39) missense probably damaging 1.00
R8326:Aox1 UTSW 1 58,335,046 (GRCm39) missense probably benign
R8415:Aox1 UTSW 1 58,080,638 (GRCm39) missense probably damaging 1.00
R8770:Aox1 UTSW 1 58,378,763 (GRCm39) missense probably benign 0.10
R8946:Aox1 UTSW 1 58,145,227 (GRCm39) missense possibly damaging 0.68
R8973:Aox1 UTSW 1 58,329,113 (GRCm39) missense probably benign 0.34
R8988:Aox1 UTSW 1 58,088,625 (GRCm39) missense possibly damaging 0.48
R9015:Aox1 UTSW 1 58,382,851 (GRCm39) missense probably damaging 1.00
R9097:Aox1 UTSW 1 58,326,887 (GRCm39) missense possibly damaging 0.82
R9101:Aox1 UTSW 1 58,371,796 (GRCm39) missense probably benign 0.03
R9108:Aox1 UTSW 1 58,321,851 (GRCm39) missense probably damaging 1.00
R9180:Aox1 UTSW 1 58,378,777 (GRCm39) nonsense probably null
R9258:Aox1 UTSW 1 58,351,515 (GRCm39) missense probably damaging 1.00
R9293:Aox1 UTSW 1 58,361,953 (GRCm39) missense possibly damaging 0.86
R9296:Aox1 UTSW 1 58,124,612 (GRCm39) missense probably damaging 1.00
R9382:Aox1 UTSW 1 58,104,501 (GRCm39) missense possibly damaging 0.48
R9461:Aox1 UTSW 1 58,116,736 (GRCm39) critical splice donor site probably null
R9519:Aox1 UTSW 1 58,373,926 (GRCm39) missense probably damaging 0.98
R9581:Aox1 UTSW 1 58,370,055 (GRCm39) critical splice donor site probably null
Z1088:Aox1 UTSW 1 58,120,701 (GRCm39) missense probably benign 0.01
Z1177:Aox1 UTSW 1 58,393,556 (GRCm39) missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TGGGAAGGTGAAGGGTAGATGTTTTACA -3'
(R):5'- AAAGTGCTGTTCTCATAGCCATGATGT -3'

Sequencing Primer
(F):5'- tgtaaatggatgtgggaagagag -3'
(R):5'- ccccctgtctcctcctc -3'
Posted On 2013-07-30