Incidental Mutation 'R8236:Cblb'
ID637378
Institutional Source Beutler Lab
Gene Symbol Cblb
Ensembl Gene ENSMUSG00000022637
Gene NameCasitas B-lineage lymphoma b
SynonymsCbl-b
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R8236 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location52031225-52208048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 52166029 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 545 (P545Q)
Ref Sequence ENSEMBL: ENSMUSP00000110115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114471]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114471
AA Change: P545Q

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637
AA Change: P545Q

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
Pfam:Cbl_N 41 167 1.5e-58 PFAM
Pfam:Cbl_N2 171 254 2.9e-43 PFAM
SH2 257 354 3.22e0 SMART
RING 373 411 1.04e-7 SMART
low complexity region 447 454 N/A INTRINSIC
low complexity region 543 567 N/A INTRINSIC
low complexity region 666 682 N/A INTRINSIC
low complexity region 773 783 N/A INTRINSIC
low complexity region 792 804 N/A INTRINSIC
low complexity region 857 871 N/A INTRINSIC
UBA 888 925 4.06e-6 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik C T 1: 86,046,393 A144V possibly damaging Het
Actr8 A G 14: 29,982,628 I51M probably damaging Het
Afm A T 5: 90,523,888 D143V probably damaging Het
Ankfy1 T A 11: 72,754,355 S753R possibly damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Birc6 G C 17: 74,611,131 L1845F probably damaging Het
Brip1 C A 11: 86,139,112 D569Y probably damaging Het
Cab39 T C 1: 85,848,371 L263P probably damaging Het
Ccdc64 T C 5: 115,649,559 H527R probably benign Het
Cdk5rap2 G T 4: 70,242,485 P1579Q probably benign Het
Cdt1 A G 8: 122,572,028 E468G probably damaging Het
Col28a1 A G 6: 8,097,024 probably null Het
Coro2a A G 4: 46,548,796 I166T possibly damaging Het
Ctnnd2 G A 15: 30,647,018 A287T probably benign Het
Dcc C T 18: 71,955,018 V50I probably benign Het
Defb30 A T 14: 63,049,767 M19K unknown Het
Edc4 A G 8: 105,892,273 T1291A possibly damaging Het
Epyc A T 10: 97,681,205 N302Y probably damaging Het
Espn G A 4: 152,149,030 T106I probably damaging Het
Fam171b G A 2: 83,880,206 E741K probably damaging Het
Fgfr1 G T 8: 25,562,272 E205* probably null Het
Flt3 A G 5: 147,356,860 S469P probably benign Het
Gdpd3 A G 7: 126,768,666 K224E probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm43518 C T 5: 123,934,222 Q17* probably null Het
Gm4353 T C 7: 116,083,383 Y321C probably damaging Het
Gphn A G 12: 78,664,537 H631R probably damaging Het
Il9 T A 13: 56,482,245 probably benign Het
Itpr2 A G 6: 146,390,783 probably null Het
Lhcgr A T 17: 88,742,586 L504* probably null Het
Mical3 A G 6: 121,012,543 V272A Het
Mup10 A G 4: 60,581,563 I63T probably damaging Het
Mxi1 C G 19: 53,369,598 P165R probably damaging Het
Nanog A T 6: 122,713,172 I179F probably benign Het
Olfr1137 T A 2: 87,711,760 I49F possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pip A G 6: 41,847,662 D28G probably damaging Het
Ppp2r3d T C 9: 124,440,067 H53R Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Ptpn4 A G 1: 119,678,822 V781A possibly damaging Het
Ptprt C T 2: 161,687,068 probably null Het
Rtf1 T C 2: 119,701,214 S141P probably damaging Het
Slc2a1 G C 4: 119,133,257 S226T probably benign Het
Sos1 T C 17: 80,408,283 E1015G probably benign Het
Sult1b1 G T 5: 87,521,524 T155N probably damaging Het
Tcam1 A G 11: 106,286,417 I412V probably benign Het
Tet2 G A 3: 133,487,786 P296S probably benign Het
Tmem30c T C 16: 57,276,179 D193G probably null Het
Trem2 G T 17: 48,351,906 W233L probably benign Het
Trpm3 C A 19: 22,987,408 D1422E probably benign Het
Ttbk1 T G 17: 46,470,729 D366A probably damaging Het
Ttyh1 G A 7: 4,125,548 G148D probably benign Het
Ubr2 T C 17: 46,951,909 M1259V probably benign Het
Zfp608 T A 18: 54,899,209 D553V probably damaging Het
Zkscan2 A G 7: 123,479,912 S941P probably benign Het
Zranb1 T C 7: 132,949,664 Y15H probably damaging Het
Other mutations in Cblb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Cblb APN 16 52183307 missense probably benign 0.28
IGL00927:Cblb APN 16 52166098 missense probably benign
IGL01108:Cblb APN 16 52047451 critical splice donor site probably null
IGL01336:Cblb APN 16 52186229 missense probably benign 0.00
IGL01943:Cblb APN 16 52139633 splice site probably null
IGL02273:Cblb APN 16 52047294 missense possibly damaging 0.95
IGL02405:Cblb APN 16 52166253 missense probably benign 0.32
IGL02445:Cblb APN 16 52166305 missense probably damaging 1.00
IGL02728:Cblb APN 16 52183309 missense probably benign 0.04
IGL03000:Cblb APN 16 52204542 missense probably damaging 1.00
PIT4362001:Cblb UTSW 16 52139542 nonsense probably null
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0053:Cblb UTSW 16 52142801 missense probably damaging 0.97
R0294:Cblb UTSW 16 52135824 missense probably damaging 1.00
R0403:Cblb UTSW 16 52152626 missense probably benign 0.23
R0506:Cblb UTSW 16 52204480 missense probably benign 0.25
R1172:Cblb UTSW 16 52186240 splice site probably benign
R1245:Cblb UTSW 16 52047187 splice site probably benign
R1443:Cblb UTSW 16 52139611 missense possibly damaging 0.95
R1549:Cblb UTSW 16 52033010 splice site probably benign
R1568:Cblb UTSW 16 52135829 missense probably damaging 1.00
R1734:Cblb UTSW 16 52186240 splice site probably benign
R2107:Cblb UTSW 16 52152716 critical splice donor site probably null
R2231:Cblb UTSW 16 52194272 missense probably benign 0.00
R4419:Cblb UTSW 16 52047258 missense possibly damaging 0.80
R4913:Cblb UTSW 16 52166029 missense possibly damaging 0.78
R4940:Cblb UTSW 16 52033103 missense probably damaging 1.00
R5159:Cblb UTSW 16 52112120 missense probably damaging 0.97
R5318:Cblb UTSW 16 52186198 missense possibly damaging 0.88
R5367:Cblb UTSW 16 52204653 missense probably damaging 1.00
R5432:Cblb UTSW 16 52142865 missense probably damaging 1.00
R5490:Cblb UTSW 16 52174370 missense possibly damaging 0.52
R5618:Cblb UTSW 16 52152668 missense possibly damaging 0.89
R6047:Cblb UTSW 16 52112248 critical splice donor site probably null
R6152:Cblb UTSW 16 52141056 missense probably damaging 0.98
R6667:Cblb UTSW 16 52152644 missense possibly damaging 0.81
R6914:Cblb UTSW 16 52047430 missense probably damaging 1.00
R7681:Cblb UTSW 16 52204638 missense probably damaging 0.96
R8167:Cblb UTSW 16 52166002 missense probably benign 0.13
X0011:Cblb UTSW 16 52152629 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTCTGGAATCACAGGAGTTTAC -3'
(R):5'- CATCACCTGGTTAGTCCCGAAG -3'

Sequencing Primer
(F):5'- CTGGAATCACAGGAGTTTACAAATTC -3'
(R):5'- AAGGCATCCCGAGGGCAC -3'
Posted On2020-07-13