Incidental Mutation 'R8236:Ttbk1'
ID637380
Institutional Source Beutler Lab
Gene Symbol Ttbk1
Ensembl Gene ENSMUSG00000015599
Gene Nametau tubulin kinase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.360) question?
Stock #R8236 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location46442448-46487675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 46470729 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 366 (D366A)
Ref Sequence ENSEMBL: ENSMUSP00000044580 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047034]
Predicted Effect probably damaging
Transcript: ENSMUST00000047034
AA Change: D366A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044580
Gene: ENSMUSG00000015599
AA Change: D366A

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 34 293 3.4e-21 PFAM
Pfam:Pkinase 34 305 1.7e-33 PFAM
low complexity region 320 334 N/A INTRINSIC
low complexity region 371 395 N/A INTRINSIC
low complexity region 570 593 N/A INTRINSIC
low complexity region 611 624 N/A INTRINSIC
low complexity region 633 653 N/A INTRINSIC
low complexity region 697 709 N/A INTRINSIC
coiled coil region 729 776 N/A INTRINSIC
low complexity region 779 797 N/A INTRINSIC
low complexity region 893 913 N/A INTRINSIC
low complexity region 945 962 N/A INTRINSIC
low complexity region 1090 1115 N/A INTRINSIC
low complexity region 1236 1251 N/A INTRINSIC
Meta Mutation Damage Score 0.0968 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.8%
  • 10x: 99.5%
  • 20x: 98.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Summary:This gene belongs to the casein kinase 1 superfamily. The encoded protein is a neuron-specific, serine/threonine and tyrosine kinase, which regulates phosphorylation of tau, a protein that associates with microtubule assemblies and stabilizes them. Genetic variants in this gene are associated with Alzheimer's disease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810459M11Rik C T 1: 86,046,393 A144V possibly damaging Het
Actr8 A G 14: 29,982,628 I51M probably damaging Het
Afm A T 5: 90,523,888 D143V probably damaging Het
Ankfy1 T A 11: 72,754,355 S753R possibly damaging Het
Aven C T 2: 112,559,775 R8W probably benign Het
Birc6 G C 17: 74,611,131 L1845F probably damaging Het
Brip1 C A 11: 86,139,112 D569Y probably damaging Het
Cab39 T C 1: 85,848,371 L263P probably damaging Het
Cblb C A 16: 52,166,029 P545Q possibly damaging Het
Ccdc64 T C 5: 115,649,559 H527R probably benign Het
Cdk5rap2 G T 4: 70,242,485 P1579Q probably benign Het
Cdt1 A G 8: 122,572,028 E468G probably damaging Het
Col28a1 A G 6: 8,097,024 probably null Het
Coro2a A G 4: 46,548,796 I166T possibly damaging Het
Ctnnd2 G A 15: 30,647,018 A287T probably benign Het
Dcc C T 18: 71,955,018 V50I probably benign Het
Defb30 A T 14: 63,049,767 M19K unknown Het
Dync2h1 C A 9: 7,080,363 probably benign Het
Edc4 A G 8: 105,892,273 T1291A possibly damaging Het
Epyc A T 10: 97,681,205 N302Y probably damaging Het
Espn G A 4: 152,149,030 T106I probably damaging Het
Fam135a T C 1: 24,020,648 probably null Het
Fam171b G A 2: 83,880,206 E741K probably damaging Het
Fgfr1 G T 8: 25,562,272 E205* probably null Het
Flt3 A G 5: 147,356,860 S469P probably benign Het
Gdpd3 A G 7: 126,768,666 K224E probably benign Het
Gm10110 C T 14: 89,898,241 V76M noncoding transcript Het
Gm43518 C T 5: 123,934,222 Q17* probably null Het
Gm4353 T C 7: 116,083,383 Y321C probably damaging Het
Gphn A G 12: 78,664,537 H631R probably damaging Het
Hook1 T A 4: 96,014,805 probably null Het
Il9 T A 13: 56,482,245 probably benign Het
Itpr2 A G 6: 146,390,783 probably null Het
Lhcgr A T 17: 88,742,586 L504* probably null Het
Mical3 A G 6: 121,012,543 V272A Het
Mup10 A G 4: 60,581,563 I63T probably damaging Het
Mxi1 C G 19: 53,369,598 P165R probably damaging Het
Nanog A T 6: 122,713,172 I179F probably benign Het
Olfr1137 T A 2: 87,711,760 I49F possibly damaging Het
Olfr921 G A 9: 38,775,281 V9M noncoding transcript Het
Pip A G 6: 41,847,662 D28G probably damaging Het
Ppp2r3d T C 9: 124,440,067 H53R Het
Psmd6 GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC GCAGAGCGGGCAGGGCATCTCACTGACCCTGTCACCTACCCAGAGCGGGCAGGGCATCTCACTGACC 14: 14,119,882 probably null Het
Ptpn4 A G 1: 119,678,822 V781A possibly damaging Het
Ptprt C T 2: 161,687,068 probably null Het
Rtf1 T C 2: 119,701,214 S141P probably damaging Het
Slc2a1 G C 4: 119,133,257 S226T probably benign Het
Smyd3 A C 1: 179,405,640 probably null Het
Sos1 T C 17: 80,408,283 E1015G probably benign Het
Sult1b1 G T 5: 87,521,524 T155N probably damaging Het
Tcam1 A G 11: 106,286,417 I412V probably benign Het
Tet2 G A 3: 133,487,786 P296S probably benign Het
Tmem30c T C 16: 57,276,179 D193G probably null Het
Trem2 G T 17: 48,351,906 W233L probably benign Het
Trpm3 C A 19: 22,987,408 D1422E probably benign Het
Ttyh1 G A 7: 4,125,548 G148D probably benign Het
Ubr2 T C 17: 46,951,909 M1259V probably benign Het
Zfp608 T A 18: 54,899,209 D553V probably damaging Het
Zkscan2 A G 7: 123,479,912 S941P probably benign Het
Zranb1 T C 7: 132,949,664 Y15H probably damaging Het
Other mutations in Ttbk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01869:Ttbk1 APN 17 46447063 missense probably damaging 1.00
IGL02469:Ttbk1 APN 17 46470630 missense possibly damaging 0.77
IGL02826:Ttbk1 APN 17 46470660 missense probably benign
IGL02874:Ttbk1 APN 17 46470225 missense probably benign 0.10
IGL02948:Ttbk1 APN 17 46446330 missense probably benign 0.44
IGL03037:Ttbk1 APN 17 46446330 missense probably benign 0.44
R0165:Ttbk1 UTSW 17 46478938 missense possibly damaging 0.70
R1186:Ttbk1 UTSW 17 46467131 missense probably damaging 1.00
R1228:Ttbk1 UTSW 17 46476712 critical splice donor site probably null
R1423:Ttbk1 UTSW 17 46446154 splice site probably benign
R1477:Ttbk1 UTSW 17 46476799 missense probably benign 0.05
R1960:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R1961:Ttbk1 UTSW 17 46480224 missense probably damaging 0.99
R4043:Ttbk1 UTSW 17 46446762 missense probably benign 0.21
R4190:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4192:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4193:Ttbk1 UTSW 17 46479247 missense probably damaging 1.00
R4660:Ttbk1 UTSW 17 46477788 nonsense probably null
R5383:Ttbk1 UTSW 17 46467416 missense probably damaging 1.00
R5385:Ttbk1 UTSW 17 46447632 missense probably benign 0.00
R5715:Ttbk1 UTSW 17 46479207 missense probably damaging 0.99
R6218:Ttbk1 UTSW 17 46470807 missense possibly damaging 0.47
R6263:Ttbk1 UTSW 17 46467262 missense probably damaging 1.00
R6471:Ttbk1 UTSW 17 46467277 missense probably benign
R6537:Ttbk1 UTSW 17 46470310 missense probably damaging 0.98
R6552:Ttbk1 UTSW 17 46478962 missense probably benign 0.14
R7564:Ttbk1 UTSW 17 46476931 missense possibly damaging 0.66
R7853:Ttbk1 UTSW 17 46447343 missense probably benign 0.00
R7871:Ttbk1 UTSW 17 46446238 missense probably benign
R7873:Ttbk1 UTSW 17 46446568 missense probably damaging 1.00
R7908:Ttbk1 UTSW 17 46478938 missense probably damaging 1.00
R8210:Ttbk1 UTSW 17 46480161 missense possibly damaging 0.95
R8754:Ttbk1 UTSW 17 46445201 nonsense probably null
R8829:Ttbk1 UTSW 17 46446895 missense probably damaging 1.00
R8870:Ttbk1 UTSW 17 46470735 missense probably damaging 1.00
X0066:Ttbk1 UTSW 17 46446856 missense possibly damaging 0.74
Z1088:Ttbk1 UTSW 17 46446325 missense probably benign 0.35
Z1176:Ttbk1 UTSW 17 46460911 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- GCCTAGATGCACTTACTTTGC -3'
(R):5'- CTTGTAGGCAGGGATGGCAATG -3'

Sequencing Primer
(F):5'- GCCAATGTTGATGCGCAG -3'
(R):5'- TACTCTGGAGATGGTCCCCAG -3'
Posted On2020-07-13