Incidental Mutation 'R0726:Rif1'
ID 63741
Institutional Source Beutler Lab
Gene Symbol Rif1
Ensembl Gene ENSMUSG00000036202
Gene Name replication timing regulatory factor 1
Synonyms 6530403D07Rik, 5730435J01Rik, D2Ertd145e
MMRRC Submission 038908-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0726 (G1)
Quality Score 189
Status Validated
Chromosome 2
Chromosomal Location 52072832-52122383 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 52110353 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 1273 (T1273M)
Ref Sequence ENSEMBL: ENSMUSP00000108313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069794] [ENSMUST00000112693]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000069794
AA Change: T1273M

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000064155
Gene: ENSMUSG00000036202
AA Change: T1273M

DomainStartEndE-ValueType
Pfam:Rif1_N 22 368 3.3e-78 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112693
AA Change: T1273M

PolyPhen 2 Score 0.517 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108313
Gene: ENSMUSG00000036202
AA Change: T1273M

DomainStartEndE-ValueType
Pfam:Rif1_N 18 381 1.4e-85 PFAM
low complexity region 432 444 N/A INTRINSIC
low complexity region 586 598 N/A INTRINSIC
low complexity region 1018 1038 N/A INTRINSIC
low complexity region 1180 1205 N/A INTRINSIC
low complexity region 1310 1321 N/A INTRINSIC
low complexity region 1423 1446 N/A INTRINSIC
low complexity region 1576 1586 N/A INTRINSIC
low complexity region 1677 1690 N/A INTRINSIC
low complexity region 1702 1712 N/A INTRINSIC
low complexity region 2176 2195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125322
Predicted Effect probably benign
Transcript: ENSMUST00000125376
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145130
Predicted Effect probably benign
Transcript: ENSMUST00000152178
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 89.2%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares homology with the yeast teleomere binding protein, Rap1 interacting factor 1. This protein localizes to aberrant telomeres may be involved in DNA repair. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. Mice homozygous for a gene trap allele exhibit embryonic and postnatal lethality, reduced fertility, and decreased cell proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg12 T C 15: 88,806,647 Y256C probably damaging Het
Alox15 T A 11: 70,350,195 D160V probably damaging Het
Aox2 T C 1: 58,334,782 probably benign Het
Bbs9 G T 9: 22,793,823 A729S probably damaging Het
Bmp2k T A 5: 97,087,494 probably benign Het
Braf C T 6: 39,662,148 R223Q possibly damaging Het
Cd101 A T 3: 101,020,622 S48T possibly damaging Het
Cdh9 T G 15: 16,831,044 D322E probably benign Het
Col28a1 C T 6: 8,014,495 probably null Het
Cpxm1 G A 2: 130,390,939 R712W probably damaging Het
Csnk1g1 T C 9: 66,032,355 probably benign Het
Cyp2d37-ps A C 15: 82,690,449 noncoding transcript Het
Cyth3 T C 5: 143,692,642 V115A probably benign Het
Dnah9 C T 11: 65,965,681 V2885M probably damaging Het
Dock9 G T 14: 121,651,768 Y326* probably null Het
Espl1 T C 15: 102,322,598 I1844T probably benign Het
Fam105a A T 15: 27,656,947 I338N probably damaging Het
Fam20a T A 11: 109,677,194 N357Y probably damaging Het
Fancc C A 13: 63,323,411 R385L probably benign Het
Foxe3 A T 4: 114,925,250 L255H unknown Het
Frem2 T C 3: 53,519,626 D2967G possibly damaging Het
Gabra6 T G 11: 42,315,127 T301P probably damaging Het
Ganab T A 19: 8,911,113 Y511N probably damaging Het
Gm498 A G 7: 143,871,761 D49G probably damaging Het
Grm4 T A 17: 27,438,438 probably benign Het
Hist1h1t G T 13: 23,696,324 K153N possibly damaging Het
Kcnj9 G A 1: 172,325,921 S212F probably damaging Het
Kif15 C A 9: 122,959,928 H62N probably benign Het
Kptn A G 7: 16,120,722 D106G probably damaging Het
Krtap13-1 T A 16: 88,729,304 S139T probably damaging Het
Lepr C A 4: 101,764,934 N354K probably benign Het
Lypd3 G T 7: 24,638,544 E112* probably null Het
Med13l A T 5: 118,748,684 N1550I probably damaging Het
Mettl2 C T 11: 105,126,844 P60L probably benign Het
Muc4 A G 16: 32,769,827 E850G probably damaging Het
Mylk G C 16: 34,879,475 E403Q possibly damaging Het
Nek1 A G 8: 61,089,592 R739G probably damaging Het
Nipbl A T 15: 8,351,555 D584E probably benign Het
Nkain3 C T 4: 20,158,388 V162M possibly damaging Het
Nmrk1 T C 19: 18,641,480 probably benign Het
Nsd2 T C 5: 33,861,028 probably benign Het
Olfr1198 A T 2: 88,746,008 N293K probably benign Het
Olfr1270 T A 2: 90,149,283 H241L probably damaging Het
Olfr133 T C 17: 38,148,624 F12S probably damaging Het
Olfr1449 T A 19: 12,935,605 V289D probably damaging Het
Olfr907 T A 9: 38,499,122 M151K possibly damaging Het
Phex T A X: 157,372,561 probably benign Het
Pip5k1b G T 19: 24,378,892 D227E probably damaging Het
Prdm13 A G 4: 21,683,914 I119T unknown Het
Rab19 G T 6: 39,383,959 V14L probably benign Het
Rasa3 A G 8: 13,580,118 probably benign Het
Rgsl1 C T 1: 153,802,328 S118N probably damaging Het
Scn8a A G 15: 100,972,830 N254S probably damaging Het
Sema6a T C 18: 47,291,981 T188A probably damaging Het
Sh3pxd2a C T 19: 47,268,762 E506K probably damaging Het
Smarca2 A T 19: 26,698,403 K1014N probably damaging Het
Smarca4 T G 9: 21,700,139 probably null Het
Sntb1 T C 15: 55,676,356 R361G probably benign Het
Soga1 G T 2: 157,060,262 R278S probably damaging Het
Stx5a T A 19: 8,754,911 I208N probably damaging Het
Tas2r102 T A 6: 132,762,452 W108R probably damaging Het
Tcl1 A G 12: 105,218,670 Y94H probably damaging Het
Tenm3 T A 8: 48,236,594 Y1986F probably damaging Het
Tet2 G A 3: 133,468,184 P1439L probably benign Het
Tiam2 T C 17: 3,512,833 probably benign Het
Ubap2l G A 3: 90,021,246 T526M probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Uhrf1bp1 T C 17: 27,885,489 V503A possibly damaging Het
Ushbp1 T A 8: 71,388,747 probably benign Het
Usp28 C T 9: 49,003,869 R115C probably damaging Het
Vldlr A T 19: 27,238,386 D261V probably damaging Het
Vmn2r5 C T 3: 64,503,765 D461N probably benign Het
Vmn2r86 A T 10: 130,446,396 F784I probably damaging Het
Zfp59 A T 7: 27,854,088 I322F probably damaging Het
Zfp607a A T 7: 27,879,149 H548L probably benign Het
Zfp626 G A 7: 27,818,623 C343Y probably damaging Het
Other mutations in Rif1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00465:Rif1 APN 2 52121007 missense probably damaging 0.96
IGL00711:Rif1 APN 2 52111070 missense probably benign 0.00
IGL00721:Rif1 APN 2 52119117 missense probably damaging 1.00
IGL01085:Rif1 APN 2 52085140 missense possibly damaging 0.71
IGL01093:Rif1 APN 2 52095948 missense probably damaging 1.00
IGL01107:Rif1 APN 2 52111303 missense probably benign 0.00
IGL01138:Rif1 APN 2 52111522 missense probably damaging 1.00
IGL01844:Rif1 APN 2 52112543 missense probably benign 0.07
IGL02441:Rif1 APN 2 52105515 missense probably benign 0.00
IGL02448:Rif1 APN 2 52116696 missense probably damaging 0.99
IGL02563:Rif1 APN 2 52077065 missense probably damaging 1.00
IGL02704:Rif1 APN 2 52093576 missense probably damaging 1.00
IGL02946:Rif1 APN 2 52110125 nonsense probably null
IGL03060:Rif1 APN 2 52112137 missense probably damaging 0.97
IGL03206:Rif1 APN 2 52103622 missense probably damaging 1.00
IGL03263:Rif1 APN 2 52090261 missense probably damaging 0.99
IGL03267:Rif1 APN 2 52076988 missense possibly damaging 0.94
IGL03280:Rif1 APN 2 52112599 missense probably benign 0.32
hifi UTSW 2 52110324 unclassified probably benign
nietzsche UTSW 2 52077020 missense probably benign 0.08
PIT4305001:Rif1 UTSW 2 52111958 missense
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0017:Rif1 UTSW 2 52116674 missense probably benign 0.18
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0060:Rif1 UTSW 2 52111117 missense probably damaging 1.00
R0104:Rif1 UTSW 2 52110092 missense possibly damaging 0.77
R0268:Rif1 UTSW 2 52090286 critical splice donor site probably null
R0276:Rif1 UTSW 2 52110324 unclassified probably benign
R0278:Rif1 UTSW 2 52110324 unclassified probably benign
R0288:Rif1 UTSW 2 52110013 missense probably damaging 1.00
R0314:Rif1 UTSW 2 52110324 unclassified probably benign
R0345:Rif1 UTSW 2 52110324 unclassified probably benign
R0346:Rif1 UTSW 2 52110324 unclassified probably benign
R0383:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R0384:Rif1 UTSW 2 52110324 unclassified probably benign
R0387:Rif1 UTSW 2 52110324 unclassified probably benign
R0388:Rif1 UTSW 2 52110324 unclassified probably benign
R0456:Rif1 UTSW 2 52110324 unclassified probably benign
R0477:Rif1 UTSW 2 52110324 unclassified probably benign
R0505:Rif1 UTSW 2 52110737 missense probably damaging 0.99
R0510:Rif1 UTSW 2 52110324 unclassified probably benign
R0511:Rif1 UTSW 2 52110324 unclassified probably benign
R0512:Rif1 UTSW 2 52110324 unclassified probably benign
R0633:Rif1 UTSW 2 52112563 missense probably benign 0.00
R0637:Rif1 UTSW 2 52110324 unclassified probably benign
R0638:Rif1 UTSW 2 52111588 missense probably benign 0.12
R0666:Rif1 UTSW 2 52110324 unclassified probably benign
R0675:Rif1 UTSW 2 52110324 unclassified probably benign
R0707:Rif1 UTSW 2 52110324 unclassified probably benign
R0743:Rif1 UTSW 2 52110324 unclassified probably benign
R0744:Rif1 UTSW 2 52110324 unclassified probably benign
R0938:Rif1 UTSW 2 52110324 unclassified probably benign
R0939:Rif1 UTSW 2 52110324 unclassified probably benign
R0940:Rif1 UTSW 2 52110324 unclassified probably benign
R0941:Rif1 UTSW 2 52110324 unclassified probably benign
R0942:Rif1 UTSW 2 52110324 unclassified probably benign
R0943:Rif1 UTSW 2 52110324 unclassified probably benign
R1006:Rif1 UTSW 2 52085029 missense probably damaging 0.99
R1052:Rif1 UTSW 2 52111562 missense probably benign 0.01
R1061:Rif1 UTSW 2 52110324 unclassified probably benign
R1175:Rif1 UTSW 2 52107628 unclassified probably benign
R1183:Rif1 UTSW 2 52110324 unclassified probably benign
R1184:Rif1 UTSW 2 52110324 unclassified probably benign
R1271:Rif1 UTSW 2 52110324 unclassified probably benign
R1332:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1336:Rif1 UTSW 2 52078314 missense probably benign 0.06
R1351:Rif1 UTSW 2 52111555 missense possibly damaging 0.74
R1517:Rif1 UTSW 2 52110324 unclassified probably benign
R1527:Rif1 UTSW 2 52110324 unclassified probably benign
R1560:Rif1 UTSW 2 52111131 missense probably damaging 1.00
R1563:Rif1 UTSW 2 52073223 missense probably damaging 0.99
R1571:Rif1 UTSW 2 52110324 unclassified probably benign
R1625:Rif1 UTSW 2 52103640 missense probably benign 0.25
R1679:Rif1 UTSW 2 52110324 unclassified probably benign
R1689:Rif1 UTSW 2 52110324 unclassified probably benign
R1731:Rif1 UTSW 2 52110324 unclassified probably benign
R1744:Rif1 UTSW 2 52112392 missense possibly damaging 0.56
R1746:Rif1 UTSW 2 52110324 unclassified probably benign
R1748:Rif1 UTSW 2 52110324 unclassified probably benign
R1831:Rif1 UTSW 2 52078495 nonsense probably null
R1902:Rif1 UTSW 2 52116673 missense possibly damaging 0.93
R1964:Rif1 UTSW 2 52098409 missense probably benign 0.01
R1978:Rif1 UTSW 2 52110324 unclassified probably benign
R2000:Rif1 UTSW 2 52081298 missense probably damaging 0.99
R2030:Rif1 UTSW 2 52092346 missense probably damaging 1.00
R2056:Rif1 UTSW 2 52093576 missense probably damaging 1.00
R2106:Rif1 UTSW 2 52110324 unclassified probably benign
R2109:Rif1 UTSW 2 52110324 unclassified probably benign
R2125:Rif1 UTSW 2 52110324 unclassified probably benign
R2126:Rif1 UTSW 2 52110324 unclassified probably benign
R2145:Rif1 UTSW 2 52111400 missense possibly damaging 0.63
R2152:Rif1 UTSW 2 52110324 unclassified probably benign
R2153:Rif1 UTSW 2 52110324 unclassified probably benign
R2213:Rif1 UTSW 2 52110324 unclassified probably benign
R2327:Rif1 UTSW 2 52110324 unclassified probably benign
R2512:Rif1 UTSW 2 52110324 unclassified probably benign
R2513:Rif1 UTSW 2 52110324 unclassified probably benign
R2516:Rif1 UTSW 2 52110324 unclassified probably benign
R2520:Rif1 UTSW 2 52110324 unclassified probably benign
R2905:Rif1 UTSW 2 52098504 missense probably damaging 0.99
R3005:Rif1 UTSW 2 52082764 missense probably damaging 1.00
R3155:Rif1 UTSW 2 52110324 unclassified probably benign
R3156:Rif1 UTSW 2 52110324 unclassified probably benign
R3429:Rif1 UTSW 2 52110324 unclassified probably benign
R3707:Rif1 UTSW 2 52093580 missense probably damaging 1.00
R3907:Rif1 UTSW 2 52112545 missense probably benign 0.03
R3978:Rif1 UTSW 2 52116747 critical splice donor site probably null
R4023:Rif1 UTSW 2 52121087 missense probably benign 0.01
R4052:Rif1 UTSW 2 52098471 nonsense probably null
R4668:Rif1 UTSW 2 52111952 missense probably benign 0.01
R4674:Rif1 UTSW 2 52106942 missense probably null 1.00
R4715:Rif1 UTSW 2 52073139 utr 5 prime probably benign
R4766:Rif1 UTSW 2 52098934 missense probably damaging 1.00
R4783:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4785:Rif1 UTSW 2 52112747 missense probably damaging 0.96
R4869:Rif1 UTSW 2 52093611 intron probably benign
R4911:Rif1 UTSW 2 52110518 missense probably damaging 0.98
R4951:Rif1 UTSW 2 52084986 splice site probably null
R5044:Rif1 UTSW 2 52109928 missense probably damaging 0.99
R5088:Rif1 UTSW 2 52092295 missense possibly damaging 0.91
R5151:Rif1 UTSW 2 52120309 missense probably damaging 1.00
R5187:Rif1 UTSW 2 52081289 missense probably damaging 1.00
R5222:Rif1 UTSW 2 52077020 missense probably benign 0.08
R5243:Rif1 UTSW 2 52111824 missense possibly damaging 0.86
R5436:Rif1 UTSW 2 52120971 intron probably benign
R5476:Rif1 UTSW 2 52089595 missense probably damaging 1.00
R5496:Rif1 UTSW 2 52098916 missense probably damaging 1.00
R5641:Rif1 UTSW 2 52121158 missense possibly damaging 0.80
R5883:Rif1 UTSW 2 52105639 critical splice donor site probably null
R5987:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5990:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R5992:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6019:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6020:Rif1 UTSW 2 52095844 missense probably damaging 1.00
R6255:Rif1 UTSW 2 52085053 missense probably damaging 1.00
R6342:Rif1 UTSW 2 52119156 missense probably damaging 0.97
R6364:Rif1 UTSW 2 52107669 missense probably damaging 0.97
R6747:Rif1 UTSW 2 52078263 splice site probably null
R6928:Rif1 UTSW 2 52095961 missense probably damaging 1.00
R6954:Rif1 UTSW 2 52112691 missense probably benign 0.00
R7003:Rif1 UTSW 2 52076989 missense probably benign 0.06
R7310:Rif1 UTSW 2 52105619 missense probably benign 0.12
R7549:Rif1 UTSW 2 52078507 missense possibly damaging 0.52
R7603:Rif1 UTSW 2 52076175 missense probably damaging 1.00
R7673:Rif1 UTSW 2 52088654 missense probably damaging 1.00
R7741:Rif1 UTSW 2 52085141 missense probably damaging 0.96
R7777:Rif1 UTSW 2 52116356 missense probably benign 0.00
R7910:Rif1 UTSW 2 52078387 nonsense probably null
R7962:Rif1 UTSW 2 52074276 missense probably damaging 1.00
R8264:Rif1 UTSW 2 52090278 missense noncoding transcript
R8390:Rif1 UTSW 2 52110923 missense probably damaging 1.00
R8479:Rif1 UTSW 2 52112551 missense possibly damaging 0.52
R8490:Rif1 UTSW 2 52110999 missense probably damaging 0.96
R8762:Rif1 UTSW 2 52111730 missense
R8785:Rif1 UTSW 2 52110481 missense probably benign 0.06
R8890:Rif1 UTSW 2 52098863 missense probably damaging 0.99
R9081:Rif1 UTSW 2 52110977 missense probably damaging 0.99
R9225:Rif1 UTSW 2 52111850 missense probably benign 0.22
R9284:Rif1 UTSW 2 52108552 missense probably benign 0.00
R9300:Rif1 UTSW 2 52111139 missense probably damaging 1.00
R9366:Rif1 UTSW 2 52120344 missense
R9477:Rif1 UTSW 2 52111330 missense probably benign 0.02
R9522:Rif1 UTSW 2 52081299 missense probably damaging 1.00
R9573:Rif1 UTSW 2 52110454 missense probably benign 0.29
R9630:Rif1 UTSW 2 52089595 missense probably damaging 1.00
X0064:Rif1 UTSW 2 52074315 missense probably benign 0.00
X0064:Rif1 UTSW 2 52094633 missense probably damaging 0.96
Z1177:Rif1 UTSW 2 52088648 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCTGTTGCTGAAACCAATCC -3'
(R):5'- TGTTCTGTTCGTGCTACAACTGAGG -3'

Sequencing Primer
(F):5'- CTAGTACAGAAACTTCGGTGGTC -3'
(R):5'- GCTACAACTGAGGCTGTACTTTC -3'
Posted On 2013-07-30